chr19-56814187-TTGGCTCAGCAGCCTCCACTTC-T

Variant names:

• chr19-56814187-TTGGCTCAGCAGCCTCCACTTC-T
• rs754092967
• NM_006210.3:c.4234_4254delGAAGTGGAGGCTGCTGAGCCA

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2 PM4 BP6

The NM_006210.3(PEG3):​c.4234_4254delGAAGTGGAGGCTGCTGAGCCA​(p.Glu1412_Pro1418del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000452 in 1,613,402 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.00040 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00046 (1 hom.)
• Consequence: PEG3 NM_006210.3 conservative_inframe_deletion
• Clinical Significance: Likely benign no assertion criteria provided B:1
• Conservation: PhyloP100: 0.988

Genes affected

PEG3 (HGNC:8826): (paternally expressed 3) In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]

ZIM2 (HGNC:12875): (zinc finger imprinted 2) In human, ZIM2 and PEG3 (GeneID:5178) are two distinct genes that share a set of 5' exons and have a common promoter, and both genes are paternally expressed. Alternative splicing events connect the shared exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. This is in contrast to mouse and cow, where ZIM2 and PEG3 genes do not share exons in common, and the imprinting status of ZIM2 is also not conserved amongst mammals. Additional 5' alternatively spliced transcripts encoding the same protein have been found for the human ZIM2 gene. [provided by RefSeq, Oct 2010]

ENSG00000286125 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_006210.3.
• BP6: Variant 19-56814187-TTGGCTCAGCAGCCTCCACTTC-T is Benign according to our data. Variant chr19-56814187-TTGGCTCAGCAGCCTCCACTTC-T is described in ClinVar as [Likely_benign]. Clinvar id is 3055579.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PEG3	NM_006210.3	c.4234_4254delGAAGTGGAGGCTGCTGAGCCA	p.Glu1412_Pro1418del	conservative_inframe_deletion	Exon 10 of 10	ENST00000326441.15	NP_006201.1
ZIM2	NM_001387356.1	c.490+3538_490+3558delGAAGTGGAGGCTGCTGAGCCA		intron_variant	Intron 9 of 12	ENST00000629319.3	NP_001374285.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PEG3	ENST00000326441.15	c.4234_4254delGAAGTGGAGGCTGCTGAGCCA	p.Glu1412_Pro1418del	conservative_inframe_deletion	Exon 10 of 10	1	NM_006210.3	ENSP00000326581.7
ZIM2	ENST00000629319.3	c.490+3538_490+3558delGAAGTGGAGGCTGCTGAGCCA		intron_variant	Intron 9 of 12	5	NM_001387356.1	ENSP00000486502.2

Frequencies

GnomAD3 genomes AF: 0.000395 AC: 60 AN: 151952 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000145

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000656

Gnomad ASJ AF: 0.00260

Gnomad EAS AF: 0.000386

Gnomad SAS AF: 0.000210

Gnomad FIN AF: 0.00170

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000338

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000515 AC: 129 AN: 250696 Hom.: 0 AF XY: 0.000516 AC XY: 70 AN XY: 135528

Gnomad AFR exome AF: 0.000247

Gnomad AMR exome AF: 0.000116

Gnomad ASJ exome AF: 0.00209

Gnomad EAS exome AF: 0.000272

Gnomad SAS exome AF: 0.000230

Gnomad FIN exome AF: 0.00162

Gnomad NFE exome AF: 0.000415

Gnomad OTH exome AF: 0.000982

GnomAD4 exome AF: 0.000458 AC: 669 AN: 1461330 Hom.: 1 AF XY: 0.000450 AC XY: 327 AN XY: 726914

Gnomad4 AFR exome AF: 0.000418

Gnomad4 AMR exome AF: 0.000134

Gnomad4 ASJ exome AF: 0.00203

Gnomad4 EAS exome AF: 0.000353

Gnomad4 SAS exome AF: 0.000174

Gnomad4 FIN exome AF: 0.00201

Gnomad4 NFE exome AF: 0.000379

Gnomad4 OTH exome AF: 0.000646

GnomAD4 genome AF: 0.000401 AC: 61 AN: 152072 Hom.: 0 Cov.: 32 AF XY: 0.000525 AC XY: 39 AN XY: 74334

Gnomad4 AFR AF: 0.000169

Gnomad4 AMR AF: 0.0000655

Gnomad4 ASJ AF: 0.00260

Gnomad4 EAS AF: 0.000387

Gnomad4 SAS AF: 0.000210

Gnomad4 FIN AF: 0.00170

Gnomad4 NFE AF: 0.000338

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000860 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: no assertion criteria provided

Submissions by phenotype

PEG3-related disorder Benign:1

Jul 20, 2020

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs754092967; hg19: chr19-57325555;