19-7522793-G-GGCGGCACCGTGGGGCCCCGA

Variant names:

• chr19-7522793-G-GGCGGCACCGTGGGGCCCCGA
• rs2022513442
• NM_020533.3:c.31+13_31+32dupGCGGCACCGTGGGGCCCCGA

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_020533.3(MCOLN1):​c.31+13_31+32dupGCGGCACCGTGGGGCCCCGA variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000375 in 1,334,754 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000034 (0 hom.)
• Consequence: MCOLN1 NM_020533.3 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.0270
• Publications: 0 publications found

Genes affected

MCOLN1 (HGNC:13356): (mucolipin TRP cation channel 1) This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]

MCOLN1 Gene-Disease associations (from GenCC):

• mucolipidosis type IV

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, ClinGen, Genomics England PanelApp, Ambry Genetics, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)
• Lisch epithelial corneal dystrophy

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ENSG00000305089 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 19-7522793-G-GGCGGCACCGTGGGGCCCCGA is Benign according to our data. Variant chr19-7522793-G-GGCGGCACCGTGGGGCCCCGA is described in ClinVar as Likely_benign. ClinVar VariationId is 2985476.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020533.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MCOLN1	NM_020533.3	MANE Select	c.31+13_31+32dupGCGGCACCGTGGGGCCCCGA		intron	N/A	NP_065394.1	Q9GZU1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MCOLN1	ENST00000264079.11	TSL:1 MANE Select	c.31+12_31+13insGCGGCACCGTGGGGCCCCGA		intron	N/A	ENSP00000264079.5	Q9GZU1
	MCOLN1	ENST00000596390.1	TSL:1	n.147+12_147+13insGCGGCACCGTGGGGCCCCGA		intron	N/A
	MCOLN1	ENST00000852002.1		c.31+12_31+13insGCGGCACCGTGGGGCCCCGA		intron	N/A	ENSP00000522061.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152218 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000338 AC: 4 AN: 1182536 Hom.: 0 Cov.: 30 AF XY: 0.00000526 AC XY: 3 AN XY: 570722

African (AFR) AF: 0.00 AC: 0 AN: 23674

American (AMR) AF: 0.00 AC: 0 AN: 9622

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16476

East Asian (EAS) AF: 0.00 AC: 0 AN: 27112

South Asian (SAS) AF: 0.00 AC: 0 AN: 46956

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 26510

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3694

European-Non Finnish (NFE) AF: 0.00000408 AC: 4 AN: 979952

Other (OTH) AF: 0.00 AC: 0 AN: 48540

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152218 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74364

African (AFR) AF: 0.00 AC: 0 AN: 41462

American (AMR) AF: 0.00 AC: 0 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10624

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68030

Other (OTH) AF: 0.00 AC: 0 AN: 2088

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	Mucolipidosis type IV (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.027

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2022513442; hg19: chr19-7587679;