2-169509861-ATGAGAAAAAATTCATCGATTGCAC-TGTCA

Position:

• chr2-169509861-ATGAGAAAAAATTCATCGATTGCAC-TGTCA

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_006063.3(KLHL41):​c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA​(p.Asp28fs) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KLHL41 NM_006063.3 frameshift, missense
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.60

Genes affected

KLHL41 (HGNC:16905): (kelch like family member 41) This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]

ENSG00000251569 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 5 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-169509861-ATGAGAAAAAATTCATCGATTGCAC-TGTCA is Pathogenic according to our data. Variant chr2-169509861-ATGAGAAAAAATTCATCGATTGCAC-TGTCA is described in ClinVar as [Likely_pathogenic]. Clinvar id is 817308.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KLHL41	NM_006063.3	c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA	p.Asp28fs	frameshift_variant, missense_variant	1/6	ENST00000284669.2	NP_006054.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KLHL41	ENST00000284669.2	c.83_107delATGAGAAAAAATTCATCGATTGCACinsTGTCA	p.Asp28fs	frameshift_variant, missense_variant	1/6	1	NM_006063.3	ENSP00000284669.1
ENSG00000251569	ENST00000513963.1	c.925-4713_925-4689delATGAGAAAAAATTCATCGATTGCACinsTGTCA		intron_variant		2		ENSP00000424363.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Mar 06, 2020

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed in large population cohorts (Lek et al., 2016); Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1574349073; hg19: chr2-170366371;