2-176093057-GGGCGGCGGCGGCGGCAGCGGCGGCTGC-G

Variant names:

• chr2-176093057-GGGCGGCGGCGGCGGCAGCGGCGGCTGC-G
• rs760539494
• NM_000523.4:c.186_212delGGCGGCTGCGGCGGCGGCGGCGGCAGC

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP3 BS1_Supporting BS2

The NM_000523.4(HOXD13):​c.186_212delGGCGGCTGCGGCGGCGGCGGCGGCAGC​(p.Ala63_Ala71del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000169 in 1,369,900 control chromosomes in the GnomAD database, including 13 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.00017 (0 hom., cov: 33)
  • Exomes 𝑓: 0.00017 (13 hom.)
• Consequence: HOXD13 NM_000523.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.39

Genes affected

HOXD13 (HGNC:5136): (homeobox D13) This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_000523.4
• BS1: Variant frequency is greater than expected in population sas. gnomad4 allele frequency = 0.000166 (25/150892) while in subpopulation SAS AF= 0.00146 (7/4796). AF 95% confidence interval is 0.000685. There are 0 homozygotes in gnomad4. There are 16 alleles in male gnomad4 subpopulation. Median coverage is 33. This position pass quality control queck. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High Homozygotes in GnomAdExome4 at 13 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HOXD13	NM_000523.4	c.186_212delGGCGGCTGCGGCGGCGGCGGCGGCAGC	p.Ala63_Ala71del	disruptive_inframe_deletion	Exon 1 of 2	ENST00000392539.4	NP_000514.2
HOXD13	XM_011511068.3	c.725-1404_725-1378delGGCGGCTGCGGCGGCGGCGGCGGCAGC		intron_variant	Intron 1 of 1		XP_011509370.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HOXD13	ENST00000392539.4	c.186_212delGGCGGCTGCGGCGGCGGCGGCGGCAGC	p.Ala63_Ala71del	disruptive_inframe_deletion	Exon 1 of 2	1	NM_000523.4	ENSP00000376322.3

Frequencies

GnomAD3 genomes AF: 0.000166 AC: 25 AN: 150784 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000970

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000132

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000195

Gnomad SAS AF: 0.00146

Gnomad FIN AF: 0.0000971

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000133

Gnomad OTH AF: 0.000485

GnomAD3 exomes AF: 0.00172 AC: 37 AN: 21526 Hom.: 8 AF XY: 0.00186 AC XY: 25 AN XY: 13458

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00588

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00450

Gnomad SAS exome AF: 0.00232

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00154

Gnomad OTH exome AF: 0.00169

GnomAD4 exome AF: 0.000170 AC: 207 AN: 1219008 Hom.: 13 AF XY: 0.000195 AC XY: 116 AN XY: 595802

Gnomad4 AFR exome AF: 0.0000416

Gnomad4 AMR exome AF: 0.000852

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000321

Gnomad4 SAS exome AF: 0.000718

Gnomad4 FIN exome AF: 0.0000974

Gnomad4 NFE exome AF: 0.000132

Gnomad4 OTH exome AF: 0.000320

GnomAD4 genome AF: 0.000166 AC: 25 AN: 150892 Hom.: 0 Cov.: 33 AF XY: 0.000217 AC XY: 16 AN XY: 73666

Gnomad4 AFR AF: 0.0000967

Gnomad4 AMR AF: 0.000132

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000196

Gnomad4 SAS AF: 0.00146

Gnomad4 FIN AF: 0.0000971

Gnomad4 NFE AF: 0.000133

Gnomad4 OTH AF: 0.000480

Alfa AF: 0.000169 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jan 06, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.186_212del, results in the deletion of 9 amino acid(s) of the HOXD13 protein (p.Ala63_Ala71del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with HOXD13-related conditions. ClinVar contains an entry for this variant (Variation ID: 2042530). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs760539494; hg19: chr2-176957785;