2-176093057-GGGCGGCGGCGGCGGCAGCGGCGGCTGC-GGGCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCGGCGGCAGCGGCGGCTGC

Variant names:

• chr2-176093057-G-GGGCGGCGGCGGCGGCAGCGGCGGCTGC
• NM_000523.4:c.186_212dupGGCGGCTGCGGCGGCGGCGGCGGCAGC

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 10P and 1B. PM2 PP5_Very_Strong BP3

The NM_000523.4(HOXD13):​c.186_212dupGGCGGCTGCGGCGGCGGCGGCGGCAGC​(p.Ala63_Ala71dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: HOXD13 NM_000523.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 0.191

Genes affected

HOXD13 (HGNC:5136): (homeobox D13) This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-176093057-G-GGGCGGCGGCGGCGGCAGCGGCGGCTGC is Pathogenic according to our data. Variant chr2-176093057-G-GGGCGGCGGCGGCGGCAGCGGCGGCTGC is described in ClinVar as [Pathogenic]. Clinvar id is 1451293.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BP3: Nonframeshift variant in repetitive region in NM_000523.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HOXD13	NM_000523.4	c.186_212dupGGCGGCTGCGGCGGCGGCGGCGGCAGC	p.Ala63_Ala71dup	disruptive_inframe_insertion	Exon 1 of 2	ENST00000392539.4	NP_000514.2
HOXD13	XM_011511068.3	c.725-1404_725-1378dupGGCGGCTGCGGCGGCGGCGGCGGCAGC		intron_variant	Intron 1 of 1		XP_011509370.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HOXD13	ENST00000392539.4	c.186_212dupGGCGGCTGCGGCGGCGGCGGCGGCAGC	p.Ala63_Ala71dup	disruptive_inframe_insertion	Exon 1 of 2	1	NM_000523.4	ENSP00000376322.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 1219028 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 595810

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

HOXD13-related disorder Pathogenic:1

Jul 05, 2023

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The HOXD13 c.186_212dup27 variant is predicted to result in an in-frame duplication (p.Ala63_Ala71dup). This variant has been reported in multiple individuals with synpolydactyly (Table1, Jourdain et al. 2020. PubMed ID: 31502745). Similar alanine repeat expansion variants have been reported in affected individuals from multiple families (Table 1, Wajid et al. 2009. PubMed ID: 19686284; Figure 3, Gong et al. 2010. PubMed ID: 20974300; Figure 6, Zhou et al. 2014. PubMed ID: 25289061). In vitro and in vivo experimental studies suggest this variant affects protein function (Basu et al. 2020. PubMed ID: 32386547). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. In summary, this variant is interpreted as pathogenic. -

not provided Pathogenic:1

Oct 31, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.186_212dup, results in the insertion of 9 amino acid(s) of the HOXD13 protein (p.Ala63_Ala71dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with synpolydactyly (PMID: 19686284, 20974300, 25289061). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 1451293). Algorithms developed to predict the effect of variants on gene product structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects HOXD13 function (PMID: 32386547). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-176957785;