2-176093061-GGCGGCGGCGGCAGCGGCGGCT-GGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCAGCGGCGGCT

Variant names:

• chr2-176093061-G-GGCGGCGGCGGCAGCGGCGGCT
• rs878854346
• NM_000523.4:c.183_203dupAGCGGCGGCTGCGGCGGCGGC

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 10P and 1B. PM2 PP5_Very_Strong BP3

The NM_000523.4(HOXD13):​c.183_203dupAGCGGCGGCTGCGGCGGCGGC​(p.Ala62_Ala68dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. A68A) has been classified as Benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000033 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: HOXD13 NM_000523.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 3.39

Genes affected

HOXD13 (HGNC:5136): (homeobox D13) This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-176093061-G-GGCGGCGGCGGCAGCGGCGGCT is Pathogenic according to our data. Variant chr2-176093061-G-GGCGGCGGCGGCAGCGGCGGCT is described in ClinVar as [Pathogenic]. Clinvar id is 1919465.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BP3: Nonframeshift variant in repetitive region in NM_000523.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HOXD13	NM_000523.4	c.183_203dupAGCGGCGGCTGCGGCGGCGGC	p.Ala62_Ala68dup	disruptive_inframe_insertion	Exon 1 of 2	ENST00000392539.4	NP_000514.2
HOXD13	XM_011511068.3	c.725-1407_725-1387dupAGCGGCGGCTGCGGCGGCGGC		intron_variant	Intron 1 of 1		XP_011509370.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HOXD13	ENST00000392539.4	c.183_203dupAGCGGCGGCTGCGGCGGCGGC	p.Ala62_Ala68dup	disruptive_inframe_insertion	Exon 1 of 2	1	NM_000523.4	ENSP00000376322.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000327 AC: 4 AN: 1224358 Hom.: 0 Cov.: 31 AF XY: 0.00000334 AC XY: 2 AN XY: 598710

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000397

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Dec 27, 2023

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Published functional studies demonstrate that poly-alanine repeat expansions in HOXA13 result in protein misfolding, degradation, and cytoplasmic aggregation (PMID: 15333588); In-frame insertion of 7 amino acids in a non-repeat region predicted to critically alter the protein; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 34094714, 15333588) -

Oct 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.183_203dup, results in the insertion of 7 amino acid(s) of the HOXD13 protein (p.Ala65_Ala71dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with HOXD13-related conditions (PMID: 19686284, 24343878). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 1919465). Algorithms developed to predict the effect of variants on gene product structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects HOXD13 function (PMID: 32386547). For these reasons, this variant has been classified as Pathogenic. -

HOXD13-related disorder Pathogenic:1

Nov 28, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: HOXD13 c.183_203dup21 (p.Ala65_Ala71dup), also annotated as c.172_192dup21 (p.Ala58_Ala64dup), results in an in-frame duplication that is predicted to expand a polyalanine repeat region by 7 amino acids in the encoded protein. The variant was absent in 21698 control chromosomes (gnomAD). c.183_203dup21 has been reported in the literature in multiple individuals affected with limb malformations including polydactyly, syndactyly, or clinodactyly (Sun_2021, Chen_2023), and was found to cosegregate with disease. These data indicate that the variant is very likely to be associated with disease. A mouse model with the same length of alanine expansion due to a 21-bp duplication shows digital malformations (Bruneau_2001). An analysis of alanine expansions of different lengths found that the +7A expansion alters the composition and properties of HOXD13-containing condensates in vivo and in vitro (Basu_2020), suggesting that altered phase separation may disrupt the transcription factor's ability to co-condense with transcriptional coactivators. The following publications have been ascertained in the context of this evaluation (PMID: 34094714, 37035736, 32386547, 11543619). One submitter has cited a clinical-significance assessment for this variant to ClinVar after 2014 and has classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878854346; hg19: chr2-176957789;