2-178639839-AACTTATTTGGTAGCTTATTTGCCTCTTCTGATATAATTTTGAAATCTTCAAATAACTAGTTTTTAAGAGAATAGTATATTAAGCATTTTGAGACGTTAGAAATCATTTGATACATACTGACTTTCACCTACTATCTTTTATTAAGTACATGTTATGTGTGTGAATACAGAAAGAATATGCTGTTGACATTGAGGATAAGCTTGCTCACCTGCTTCGGGCTTTGGTTTCGGTTCAG-A

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2

The NM_001267550.2(TTN):​c.40760_40787-52del​(p.Pro13587_Glu13596delinsGln) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

TTN
NM_001267550.2 splice_donor, disruptive_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.557
Variant links:
Genes affected
TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 8.2425727E-4 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
TTNNM_001267550.2 linkc.40760_40787-52del p.Pro13587_Glu13596delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 222/363 ENST00000589042.5 NP_001254479.2 A0A0A0MTS7

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
TTNENST00000589042.5 linkc.40760_40787-52del p.Pro13587_Glu13596delinsGln splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant 222/3635 NM_001267550.2 ENSP00000467141.1 A0A0A0MTS7

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpFeb 03, 2022In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant is located in the I band of TTN (PMID: 25589632). Truncating variants in this region have been shown to be highly prevalent in the general population and unaffected individuals (PMID: 26701604, 22335739). However, truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). ClinVar contains an entry for this variant (Variation ID: 404648). This variant has not been reported in the literature in individuals affected with TTN-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 222 (c.40760_40787-52del) of the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553752889; hg19: chr2-179504566; API