2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-C

Variant names:

• chr2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-C
• rs57674096
• NM_014905.5:c.-203_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS1

The NM_014905.5(GLS):​c.-203_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000942 in 743,090 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0000084 (0 hom.)
• Consequence: GLS NM_014905.5 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.335

Genes affected

GLS (HGNC:4331): (glutaminase) This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]

ENSG00000235852 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS1: Variant frequency is greater than expected in population amr. gnomad4_exome allele frequency = 0.00000842 (5/593578) while in subpopulation AMR AF= 0.0000643 (2/31118). AF 95% confidence interval is 0.0000106. There are 0 homozygotes in gnomad4_exome. There are 4 alleles in male gnomad4_exome subpopulation. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GLS	NM_014905.5	c.-203_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	ENST00000320717.8	NP_055720.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GLS	ENST00000320717	c.-203_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	1	NM_014905.5	ENSP00000317379.3
GLS	ENST00000338435	c.-203_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 15	1		ENSP00000340689.4
GLS	ENST00000479552.1	n.11_49delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 1 of 2	1
ENSG00000235852	ENST00000413911.1	n.805_843delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 2 of 2	3

Frequencies

GnomAD3 genomes AF: 0.0000134 AC: 2 AN: 149512 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000201

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000149

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000842 AC: 5 AN: 593578 Hom.: 0 AF XY: 0.0000126 AC XY: 4 AN XY: 316268

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000643

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000798

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000134 AC: 2 AN: 149512 Hom.: 0 Cov.: 0 AF XY: 0.0000137 AC XY: 1 AN XY: 72816

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000201

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000149

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs57674096; hg19: chr2-191745598;