2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCA

Variant names:

• chr2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-C
• rs57674096
• NM_014905.5:c.-197_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_014905.5(GLS):​c.-197_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000265 in 743,152 control chromosomes in the GnomAD database, including 2 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00047 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00021 (2 hom.)
• Consequence: GLS NM_014905.5 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.335

Genes affected

GLS (HGNC:4331): (glutaminase) This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]

ENSG00000235852 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.000475 (71/149612) while in subpopulation AMR AF= 0.00152 (23/15112). AF 95% confidence interval is 0.00104. There are 0 homozygotes in gnomad4. There are 31 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High Homozygotes in GnomAdExome4 at 2 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GLS	NM_014905.5	c.-197_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	ENST00000320717.8	NP_055720.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GLS	ENST00000320717	c.-197_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	1	NM_014905.5	ENSP00000317379.3
GLS	ENST00000338435	c.-197_-165delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 15	1		ENSP00000340689.4
GLS	ENST00000479552.1	n.17_49delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 1 of 2	1
ENSG00000235852	ENST00000413911.1	n.811_843delTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 2 of 2	3

Frequencies

GnomAD3 genomes AF: 0.000475 AC: 71 AN: 149512 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000148

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00152

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000402

Gnomad SAS AF: 0.000427

Gnomad FIN AF: 0.000294

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000491

Gnomad OTH AF: 0.000977

GnomAD4 exome AF: 0.000212 AC: 126 AN: 593540 Hom.: 2 AF XY: 0.000212 AC XY: 67 AN XY: 316246

Gnomad4 AFR exome AF: 0.000198

Gnomad4 AMR exome AF: 0.000193

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000162

Gnomad4 FIN exome AF: 0.000127

Gnomad4 NFE exome AF: 0.000263

Gnomad4 OTH exome AF: 0.000329

GnomAD4 genome AF: 0.000475 AC: 71 AN: 149612 Hom.: 0 Cov.: 0 AF XY: 0.000425 AC XY: 31 AN XY: 72928

Gnomad4 AFR AF: 0.000147

Gnomad4 AMR AF: 0.00152

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000403

Gnomad4 SAS AF: 0.000428

Gnomad4 FIN AF: 0.000294

Gnomad4 NFE AF: 0.000491

Gnomad4 OTH AF: 0.000966

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs57674096; hg19: chr2-191745598;