2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCAGCAGCAGCA

Variant names:

• chr2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCA-C
• rs57674096
• NM_014905.5:c.-188_-165delGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The NM_014905.5(GLS):​c.-188_-165delGCAGCAGCAGCAGCAGCAGCAGCA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.32 (7964 hom., cov: 0)
  • Exomes 𝑓: 0.18 (17734 hom.)
  • Failed GnomAD Quality Control
• Consequence: GLS NM_014905.5 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.335

Genes affected

GLS (HGNC:4331): (glutaminase) This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]

ENSG00000235852 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.435 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GLS	NM_014905.5	c.-188_-165delGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	ENST00000320717.8	NP_055720.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GLS	ENST00000320717	c.-188_-165delGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	1	NM_014905.5	ENSP00000317379.3
GLS	ENST00000338435	c.-188_-165delGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 15	1		ENSP00000340689.4
GLS	ENST00000479552.1	n.26_49delGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 1 of 2	1
ENSG00000235852	ENST00000413911.1	n.820_843delTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 2 of 2	3

Frequencies

GnomAD3 genomes AF: 0.317 AC: 47436 AN: 149434 Hom.: 7965 Cov.: 0

Gnomad AFR AF: 0.216

Gnomad AMI AF: 0.506

Gnomad AMR AF: 0.260

Gnomad ASJ AF: 0.432

Gnomad EAS AF: 0.451

Gnomad SAS AF: 0.203

Gnomad FIN AF: 0.353

Gnomad MID AF: 0.328

Gnomad NFE AF: 0.376

Gnomad OTH AF: 0.322

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.182 AC: 102021 AN: 559060 Hom.: 17734 AF XY: 0.177 AC XY: 52675 AN XY: 297868

Gnomad4 AFR exome AF: 0.0988

Gnomad4 AMR exome AF: 0.0718

Gnomad4 ASJ exome AF: 0.215

Gnomad4 EAS exome AF: 0.375

Gnomad4 SAS exome AF: 0.0661

Gnomad4 FIN exome AF: 0.246

Gnomad4 NFE exome AF: 0.191

Gnomad4 OTH exome AF: 0.199

GnomAD4 genome AF: 0.317 AC: 47451 AN: 149534 Hom.: 7964 Cov.: 0 AF XY: 0.314 AC XY: 22861 AN XY: 72880

Gnomad4 AFR AF: 0.216

Gnomad4 AMR AF: 0.259

Gnomad4 ASJ AF: 0.432

Gnomad4 EAS AF: 0.451

Gnomad4 SAS AF: 0.202

Gnomad4 FIN AF: 0.353

Gnomad4 NFE AF: 0.376

Gnomad4 OTH AF: 0.325

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs57674096; hg19: chr2-191745598;