2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr2-190880872-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
• rs57674096
• NM_014905.5:c.-197_-165dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS1

The NM_014905.5(GLS):​c.-197_-165dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00048 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00052 (8 hom.)
  • Failed GnomAD Quality Control
• Consequence: GLS NM_014905.5 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.922

Genes affected

GLS (HGNC:4331): (glutaminase) This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]

ENSG00000235852 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.000481 (72/149608) while in subpopulation NFE AF= 0.000699 (47/67252). AF 95% confidence interval is 0.00054. There are 0 homozygotes in gnomad4. There are 36 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GLS	NM_014905.5	c.-197_-165dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	ENST00000320717.8	NP_055720.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GLS	ENST00000320717	c.-197_-165dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 18	1	NM_014905.5	ENSP00000317379.3
GLS	ENST00000338435	c.-197_-165dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		5_prime_UTR_variant	Exon 1 of 15	1		ENSP00000340689.4
GLS	ENST00000479552.1	n.17_49dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 1 of 2	1
ENSG00000235852	ENST00000413911.1	n.811_843dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 2 of 2	3

Frequencies

GnomAD3 genomes AF: 0.000475 AC: 71 AN: 149508 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000468

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000133

Gnomad ASJ AF: 0.000580

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00318

Gnomad NFE AF: 0.000699

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000516 AC: 306 AN: 593538 Hom.: 8 Cov.: 0 AF XY: 0.000481 AC XY: 152 AN XY: 316232

Gnomad4 AFR exome AF: 0.000659

Gnomad4 AMR exome AF: 0.0000964

Gnomad4 ASJ exome AF: 0.000341

Gnomad4 EAS exome AF: 0.000253

Gnomad4 SAS exome AF: 0.000323

Gnomad4 FIN exome AF: 0.000446

Gnomad4 NFE exome AF: 0.000583

Gnomad4 OTH exome AF: 0.000823

GnomAD4 genome AF: 0.000481 AC: 72 AN: 149608 Hom.: 0 Cov.: 0 AF XY: 0.000494 AC XY: 36 AN XY: 72926

Gnomad4 AFR AF: 0.000467

Gnomad4 AMR AF: 0.000132

Gnomad4 ASJ AF: 0.000580

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000699

Gnomad4 OTH AF: 0.000483

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs57674096; hg19: chr2-191745598;