2-197494591-CAGATAACTCAAACTTTTGATCATA-CAGATAACTCAAACTTTTGATCATAAGATAACTCAAACTTTTGATCATA

Variant names:

• chr2-197494591-C-CAGATAACTCAAACTTTTGATCATA
• rs3214832
• NM_002156.5:c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_002156.5(HSPD1):​c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 29)
• Consequence: HSPD1 NM_002156.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.194
• Publications: 2 publications found

Genes affected

HSPD1 (HGNC:5261): (heat shock protein family D (Hsp60) member 1) This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]

HSPD1 Gene-Disease associations (from GenCC):

• hereditary spastic paraplegia 13

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• hypomyelinating leukodystrophy 4

  Inheritance: AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HSPD1	NM_002156.5	c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT		intron_variant	Intron 5 of 11	ENST00000388968.8	NP_002147.2
HSPD1	NM_199440.2	c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT		intron_variant	Intron 5 of 11		NP_955472.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HSPD1	ENST00000388968.8	c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT		intron_variant	Intron 5 of 11	1	NM_002156.5	ENSP00000373620.3

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome Cov.: 8

GnomAD4 genome Cov.: 29

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.19

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3214832; hg19: chr2-198359315;