rs3214832

Variant names:

• chr2-197494591-CAGATAACTCAAACTTTTGATCATA-C
• rs3214832
• NM_002156.5:c.606+42_606+65delTATGATCAAAAGTTTGAGTTATCT

Your query was ambiguous. Multiple possible variants found:

• chr2-197494591-CAGATAACTCAAACTTTTGATCATA-C
• chr2-197494591-CAGATAACTCAAACTTTTGATCATA-CAGATAACTCAAACTTTTGATCATAAGATAACTCAAACTTTTGATCATA

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_002156.5(HSPD1):​c.606+42_606+65delTATGATCAAAAGTTTGAGTTATCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.199 in 1,153,152 control chromosomes in the GnomAD database, including 20,383 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.17 (2262 hom., cov: 29)
  • Exomes 𝑓: 0.20 (18121 hom.)
• Consequence: HSPD1 NM_002156.5 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.01
• Publications: 2 publications found

Genes affected

HSPD1 (HGNC:5261): (heat shock protein family D (Hsp60) member 1) This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]

HSPD1 Gene-Disease associations (from GenCC):

• hereditary spastic paraplegia 13

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• hypomyelinating leukodystrophy 4

  Inheritance: AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet, Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 2-197494591-CAGATAACTCAAACTTTTGATCATA-C is Benign according to our data. Variant chr2-197494591-CAGATAACTCAAACTTTTGATCATA-C is described in ClinVar as Benign. ClinVar VariationId is 1259574.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.227 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HSPD1	NM_002156.5	c.606+42_606+65delTATGATCAAAAGTTTGAGTTATCT		intron_variant	Intron 5 of 11	ENST00000388968.8	NP_002147.2
HSPD1	NM_199440.2	c.606+42_606+65delTATGATCAAAAGTTTGAGTTATCT		intron_variant	Intron 5 of 11		NP_955472.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HSPD1	ENST00000388968.8	c.606+42_606+65delTATGATCAAAAGTTTGAGTTATCT		intron_variant	Intron 5 of 11	1	NM_002156.5	ENSP00000373620.3

Frequencies

GnomAD3 genomes AF: 0.167 AC: 25421 AN: 151928 Hom.: 2259 Cov.: 29

Gnomad AFR AF: 0.109

Gnomad AMI AF: 0.193

Gnomad AMR AF: 0.197

Gnomad ASJ AF: 0.234

Gnomad EAS AF: 0.237

Gnomad SAS AF: 0.116

Gnomad FIN AF: 0.183

Gnomad MID AF: 0.278

Gnomad NFE AF: 0.187

Gnomad OTH AF: 0.194

GnomAD4 exome AF: 0.204 AC: 203885 AN: 1001106 Hom.: 18121 AF XY: 0.200 AC XY: 103537 AN XY: 517282

African (AFR) AF: 0.120 AC: 2845 AN: 23636

American (AMR) AF: 0.198 AC: 8410 AN: 42374

Ashkenazi Jewish (ASJ) AF: 0.241 AC: 5563 AN: 23102

East Asian (EAS) AF: 0.239 AC: 8966 AN: 37566

South Asian (SAS) AF: 0.124 AC: 9270 AN: 75022

European-Finnish (FIN) AF: 0.186 AC: 9851 AN: 53062

Middle Eastern (MID) AF: 0.267 AC: 930 AN: 3488

European-Non Finnish (NFE) AF: 0.214 AC: 149081 AN: 697802

Other (OTH) AF: 0.199 AC: 8969 AN: 45054

GnomAD4 genome AF: 0.167 AC: 25452 AN: 152046 Hom.: 2262 Cov.: 29 AF XY: 0.168 AC XY: 12502 AN XY: 74338

African (AFR) AF: 0.109 AC: 4537 AN: 41492

American (AMR) AF: 0.196 AC: 2999 AN: 15282

Ashkenazi Jewish (ASJ) AF: 0.234 AC: 809 AN: 3464

East Asian (EAS) AF: 0.238 AC: 1230 AN: 5174

South Asian (SAS) AF: 0.117 AC: 566 AN: 4818

European-Finnish (FIN) AF: 0.183 AC: 1939 AN: 10572

Middle Eastern (MID) AF: 0.282 AC: 83 AN: 294

European-Non Finnish (NFE) AF: 0.187 AC: 12699 AN: 67926

Other (OTH) AF: 0.196 AC: 414 AN: 2114

Alfa AF: 0.167 Hom.: 222

Asia WGS AF: 0.176 AC: 610 AN: 3474

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Jun 29, 2018

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.0
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3214832; hg19: chr2-198359315; COSMIC: COSV61443850; COSMIC: COSV61443850;