2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATAT

Variant names:

• chr2-203873327-C-CATATAT
• rs60872763
• NM_005214.5:c.*566_*571dupATATAT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_005214.5(CTLA4):​c.*566_*571dupATATAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. There is a variant allele frequency bias in the population database for this variant (GnomAd4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene CTLA4 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: 𝑓 0.00028 (0 hom., cov: 0)
• Consequence: CTLA4 NM_005214.5 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.83
• Publications: 3 publications found

Genes affected

CTLA4 (HGNC:2505): (cytotoxic T-lymphocyte associated protein 4) This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008]

CTLA4 Gene-Disease associations (from GenCC):

• autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for CTLA4 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005214.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTLA4	NM_005214.5	MANE Select	c.*566_*571dupATATAT		3_prime_UTR	Exon 4 of 4	NP_005205.2
	CTLA4	NM_001037631.3		c.*603_*608dupATATAT		3_prime_UTR	Exon 3 of 3	NP_001032720.1	P16410-5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTLA4	ENST00000648405.2	MANE Select	c.*566_*571dupATATAT		3_prime_UTR	Exon 4 of 4	ENSP00000497102.1	P16410-1
	CTLA4	ENST00000696479.1		c.*566_*571dupATATAT		3_prime_UTR	Exon 5 of 5	ENSP00000512655.1	A0A8Q3SIR7
	CTLA4	ENST00000696049.1		c.*515_*516insATATAT		downstream_gene	N/A	ENSP00000512353.1	A0A8Q3WKZ2

Frequencies

GnomAD3 genomes AF: 0.000279 AC: 34 AN: 122072 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000135

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000163

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000235

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000451

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.000279 AC: 34 AN: 122062 Hom.: 0 Cov.: 0 AF XY: 0.000206 AC XY: 12 AN XY: 58180

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000135 AC: 4 AN: 29566

American (AMR) AF: 0.000163 AC: 2 AN: 12280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3186

East Asian (EAS) AF: 0.000236 AC: 1 AN: 4242

South Asian (SAS) AF: 0.00 AC: 0 AN: 4328

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 5810

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 232

European-Non Finnish (NFE) AF: 0.000451 AC: 27 AN: 59884

Other (OTH) AF: 0.00 AC: 0 AN: 1736

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.00000000030572), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60872763; hg19: chr2-204738050;