2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATAT

Position:

• chr2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATAT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_005214.5(CTLA4):​c.*566_*571dupATATAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.00028 (0 hom., cov: 0)
• Consequence: CTLA4 NM_005214.5 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.83

Genes affected

CTLA4 (HGNC:2505): (cytotoxic T-lymphocyte associated protein 4) This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.000279 (34/122062) while in subpopulation NFE AF= 0.000451 (27/59884). AF 95% confidence interval is 0.000318. There are 0 homozygotes in gnomad4. There are 12 alleles in male gnomad4 subpopulation. Median coverage is 0. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 34 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CTLA4	NM_005214.5	c.*566_*571dupATATAT		3_prime_UTR_variant	4/4	ENST00000648405.2	NP_005205.2
CTLA4	NM_001037631.3	c.*603_*608dupATATAT		3_prime_UTR_variant	3/3		NP_001032720.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CTLA4	ENST00000648405.2	c.*566_*571dupATATAT		3_prime_UTR_variant	4/4		NM_005214.5	ENSP00000497102.1
CTLA4	ENST00000696479.1	c.*566_*571dupATATAT		3_prime_UTR_variant	5/5			ENSP00000512655.1

Frequencies

GnomAD3 genomes AF: 0.000279 AC: 34 AN: 122072 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000135

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000163

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000235

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000451

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.000279 AC: 34 AN: 122062 Hom.: 0 Cov.: 0 AF XY: 0.000206 AC XY: 12 AN XY: 58180

Gnomad4 AFR AF: 0.000135

Gnomad4 AMR AF: 0.000163

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000236

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000451

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60872763; hg19: chr2-204738050;