2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATATAT

Position:

• chr2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATATAT

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_005214.5(CTLA4):​c.*564_*571dupATATATAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000057 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CTLA4 NM_005214.5 3_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.83

Genes affected

CTLA4 (HGNC:2505): (cytotoxic T-lymphocyte associated protein 4) This gene is a member of the immunoglobulin superfamily and encodes a protein which transmits an inhibitory signal to T cells. The protein contains a V domain, a transmembrane domain, and a cytoplasmic tail. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The membrane-bound isoform functions as a homodimer interconnected by a disulfide bond, while the soluble isoform functions as a monomer. Mutations in this gene have been associated with insulin-dependent diabetes mellitus, Graves disease, Hashimoto thyroiditis, celiac disease, systemic lupus erythematosus, thyroid-associated orbitopathy, and other autoimmune diseases. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 7 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CTLA4	NM_005214.5	c.*564_*571dupATATATAT		3_prime_UTR_variant	4/4	ENST00000648405.2	NP_005205.2
CTLA4	NM_001037631.3	c.*601_*608dupATATATAT		3_prime_UTR_variant	3/3		NP_001032720.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CTLA4	ENST00000648405.2	c.*564_*571dupATATATAT		3_prime_UTR_variant	4/4		NM_005214.5	ENSP00000497102.1
CTLA4	ENST00000696479.1	c.*564_*571dupATATATAT		3_prime_UTR_variant	5/5			ENSP00000512655.1

Frequencies

GnomAD3 genomes AF: 0.0000573 AC: 7 AN: 122096 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000677

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000835

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 61238 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 30886

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000573 AC: 7 AN: 122086 Hom.: 0 Cov.: 0 AF XY: 0.0000516 AC XY: 3 AN XY: 58192

Gnomad4 AFR AF: 0.0000676

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000835

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs60872763; hg19: chr2-204738050;