2-203873327-CATATATATATATATATATATATATATATATATATATATATATATAT-CATATATATATATATATATATATATATATATATATATATATATATATATATATAT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_005214.5(CTLA4):c.*564_*571dupATATATAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. There is a variant allele frequency bias in the population database for this variant (GnomAd4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. The gene CTLA4 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_005214.5 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiencyInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005214.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CTLA4 | MANE Select | c.*564_*571dupATATATAT | 3_prime_UTR | Exon 4 of 4 | ENSP00000497102.1 | P16410-1 | |||
| CTLA4 | c.*564_*571dupATATATAT | 3_prime_UTR | Exon 5 of 5 | ENSP00000512655.1 | A0A8Q3SIR7 | ||||
| CTLA4 | c.*515_*516insATATATAT | downstream_gene | N/A | ENSP00000512353.1 | A0A8Q3WKZ2 |
Frequencies
GnomAD3 genomes AF: 0.0000573 AC: 7AN: 122096Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0AN: 61238Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 30886
GnomAD4 genome AF: 0.0000573 AC: 7AN: 122086Hom.: 0 Cov.: 0 AF XY: 0.0000516 AC XY: 3AN XY: 58192 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at