2-209772013-G-GCGGCGGCTAGCGAGGAGACAGAGCTGGGTCCTGCAGTAGGACTCCCGGGAGCCACCATTATGGTGAAGAGGAAGAGCTCCGAGGGCCAGGAGCAGGA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001371986.1(UNC80):c.-52_45dup variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000883 in 1,132,512 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 8.8e-7 (0 hom.)
• Consequence: UNC80 NM_001371986.1 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.0290

Genes affected

UNC80 (HGNC:26582): (unc-80 homolog, NALCN channel complex subunit) The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
UNC80	NM_001371986.1	c.-52_45dup		5_prime_UTR_variant	1/65	ENST00000673920.1
UNC80	NM_032504.2	c.-52_45dup		5_prime_UTR_variant	1/64
UNC80	NM_182587.4	c.-52_45dup		5_prime_UTR_variant	1/63

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
UNC80	ENST00000673920.1	c.-52_45dup		5_prime_UTR_variant	1/65		NM_001371986.1	A2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 8.83e-7 AC: 1 AN: 1132512 Hom.: 0 Cov.: 15 AF XY: 0.00000175 AC XY: 1 AN XY: 570548

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000119

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Aug 09, 2022

This variant is not present in population databases (gnomAD no frequency). This variant occurs in a non-coding region of the UNC80 gene. It does not change the encoded amino acid sequence of the UNC80 protein. This variant has not been reported in the literature in individuals affected with UNC80-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. ClinVar contains an entry for this variant (Variation ID: 1352691). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr2-210636737;