2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000465.4(BARD1):c.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG(p.Val559fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
BARD1
NM_000465.4 frameshift, splice_donor, splice_region, intron
NM_000465.4 frameshift, splice_donor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 1.96
Genes affected
BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T is Pathogenic according to our data. Variant chr2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 530138.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
BARD1 | NM_000465.4 | c.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG | p.Val559fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | 7/11 | ENST00000260947.9 | NP_000456.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
BARD1 | ENST00000260947.9 | c.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG | p.Val559fs | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | 7/11 | 1 | NM_000465.4 | ENSP00000260947.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Familial cancer of breast Pathogenic:2
Likely pathogenic, criteria provided, single submitter | clinical testing | Myriad Genetics, Inc. | May 23, 2023 | This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. - |
Likely pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jun 04, 2018 | This sequence change deletes 25 nucleotides at the exon 7 and intron 7 junction of the BARD1 gene and affects a donor splice site. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with BARD1-related disease. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at