rs1553616339

Variant names:

• chr2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T
• rs1553616339
• ENST00000620057.4:c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PP5_Very_Strong

The ENST00000620057.4(BARD1):​c.*342_*343+23delTAGTAAGTATGGATTTAGCTTTGGG variant causes a splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BARD1 ENST00000620057.4 splice_region
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 1.96
• Publications: 1 publications found

Genes affected

BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

BARD1 Gene-Disease associations (from GenCC):

• breast cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
• familial ovarian cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PP5: Variant 2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T is Pathogenic according to our data. Variant chr2-214752423-TCCCAAAGCTAAATCCATACTTACTA-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 530138.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BARD1	NM_000465.4	c.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG	p.Val559fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 7 of 11	ENST00000260947.9	NP_000456.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BARD1	ENST00000260947.9	c.1676_1677+23delTAGTAAGTATGGATTTAGCTTTGGG	p.Val559fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 7 of 11	1	NM_000465.4	ENSP00000260947.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast Pathogenic:2

May 23, 2023

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

Jun 04, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has not been reported in the literature in individuals with BARD1-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change deletes 25 nucleotides at the exon 7 and intron 7 junction of the BARD1 gene and affects a donor splice site. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. Donor and acceptor splice site variants typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553616339; hg19: chr2-215617147;