2-219570191-CCCCTCCCTAGGTCCCGGGCTCCGCCGTACCTTTCA-C

Position:

• chr2-219570191-CCCCTCCCTAGGTCCCGGGCTCCGCCGTACCTTTCA-C

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_015311.3(OBSL1):​c.1007_1012+29delTGAAAGGTACGGCGGAGCCCGGGACCTAGGGAGGG​(p.Val336_Lys337del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000801 in 1,497,326 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000082 (0 hom.)
• Consequence: OBSL1 NM_015311.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.21

Genes affected

OBSL1 (HGNC:29092): (obscurin like cytoskeletal adaptor 1) Cytoskeletal adaptor proteins function in linking the internal cytoskeleton of cells to the cell membrane. This gene encodes a cytoskeletal adaptor protein, which is a member of the Unc-89/obscurin family. The protein contains multiple N- and C-terminal immunoglobulin (Ig)-like domains and a central fibronectin type 3 domain. Mutations in this gene cause 3M syndrome type 2. Alternatively spliced transcript variants encoding different isoforms have been found in this gene. [provided by RefSeq, Mar 2010]

OBSL1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease,
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-219570191-CCCCTCCCTAGGTCCCGGGCTCCGCCGTACCTTTCA-C is Pathogenic according to our data. Variant chr2-219570191-CCCCTCCCTAGGTCCCGGGCTCCGCCGTACCTTTCA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1489382.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
OBSL1	NM_015311.3	c.1007_1012+29delTGAAAGGTACGGCGGAGCCCGGGACCTAGGGAGGG	p.Val336_Lys337del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	1/21	ENST00000404537.6	NP_056126.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
OBSL1	ENST00000404537.6	c.1007_1012+29delTGAAAGGTACGGCGGAGCCCGGGACCTAGGGAGGG	p.Val336_Lys337del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	1/21	1	NM_015311.3	ENSP00000385636.1

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152226 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.00000798 AC: 1 AN: 125288 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 67520

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000181

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000818 AC: 11 AN: 1345100 Hom.: 0 AF XY: 0.00000912 AC XY: 6 AN XY: 657712

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000104

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152226 Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0 AN XY: 74370

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

Bravo AF: 0.00000378

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Apr 03, 2021

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with OBSL1-related conditions. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This variant results in the deletion of part of exon 1 of the OBSL1 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in OBSL1 are known to be pathogenic (PMID: 19481195, 19877176). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1025372068; hg19: chr2-220434913;