chr2-219570191-CCCCTCCCTAGGTCCCGGGCTCCGCCGTACCTTTCA-C
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_015311.3(OBSL1):c.1007_1012+29delTGAAAGGTACGGCGGAGCCCGGGACCTAGGGAGGG(p.Val336_Lys337del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000801 in 1,497,326 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_015311.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
OBSL1 | ENST00000404537.6 | c.1007_1012+29delTGAAAGGTACGGCGGAGCCCGGGACCTAGGGAGGG | p.Val336_Lys337del | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | Exon 1 of 21 | 1 | NM_015311.3 | ENSP00000385636.1 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152226Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.00000798 AC: 1AN: 125288Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 67520
GnomAD4 exome AF: 0.00000818 AC: 11AN: 1345100Hom.: 0 AF XY: 0.00000912 AC XY: 6AN XY: 657712
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152226Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74370
ClinVar
Submissions by phenotype
not provided Pathogenic:1
In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with OBSL1-related conditions. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This variant results in the deletion of part of exon 1 of the OBSL1 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in OBSL1 are known to be pathogenic (PMID: 19481195, 19877176). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at