2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000251.3(MSH2):c.269_290dupAAGATCTTCTTCTGGTTCGTCA(p.Tyr98ArgfsTer9) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. Q97Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000251.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Lynch syndrome Pathogenic:1
Coding sequence variation resulting in a stop codon -
Muir-Torré syndrome Pathogenic:1
- -
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
This sequence change creates a premature translational stop signal (p.Tyr98Argfs*9) in the MSH2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Muir-Torre syndrome (PMID: 9217825). This variant is also known as 289ins22. ClinVar contains an entry for this variant (Variation ID: 1761). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at