rs1553350126

Positions:

• chr2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_001406654.1(MSH2):​c.-129-23_-129-2dupAAGATCTTCTTCTGGTTCGTCA variant causes a splice acceptor, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MSH2 NM_001406654.1 splice_acceptor, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:2
• Conservation: PhyloP100: 6.19

Genes affected

MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

MSH2 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.031543054 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC is Pathogenic according to our data. Variant chr2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC is described in ClinVar as [Pathogenic]. Clinvar id is 1761.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MSH2	NM_000251.3	c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98fs	frameshift_variant	2/16	ENST00000233146.7	NP_000242.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MSH2	ENST00000233146.7	c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98fs	frameshift_variant	2/16	1	NM_000251.3	ENSP00000233146.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: reviewed by expert panel

Submissions by phenotype

Lynch syndrome Pathogenic:1

Pathogenic, reviewed by expert panel

research

International Society for Gastrointestinal Hereditary Tumours (InSiGHT)

Sep 05, 2013

Coding sequence variation resulting in a stop codon -

Muir-Torré syndrome Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jun 01, 1997

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553350126; hg19: chr2-47635595;