rs1553350126

Variant names:

• chr2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC
• rs1553350126
• NM_000251.3:c.269_290dupAAGATCTTCTTCTGGTTCGTCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000251.3(MSH2):​c.269_290dupAAGATCTTCTTCTGGTTCGTCA​(p.Tyr98ArgfsTer9) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. Q97Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MSH2 NM_000251.3 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:3
• Conservation: PhyloP100: 6.19
• Publications: 1 publications found

Genes affected

MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

MSH2 Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
• Lynch syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• Muir-Torre syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
• mismatch repair cancer syndrome 1

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• mismatch repair cancer syndrome 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• ovarian cancer

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• malignant pancreatic neoplasm

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• prostate cancer

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• breast cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC is Pathogenic according to our data. Variant chr2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC is described in ClinVar as Pathogenic. ClinVar VariationId is 1761.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MSH2	NM_000251.3	c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift_variant	Exon 2 of 16	ENST00000233146.7	NP_000242.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MSH2	ENST00000233146.7	c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift_variant	Exon 2 of 16	1	NM_000251.3	ENSP00000233146.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: reviewed by expert panel

Submissions by phenotype

Lynch syndrome Pathogenic:1

Sep 05, 2013

International Society for Gastrointestinal Hereditary Tumours (InSiGHT)

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: research

Coding sequence variation resulting in a stop codon -

Muir-Torré syndrome Pathogenic:1

Jun 01, 1997

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Oct 24, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Tyr98Argfs*9) in the MSH2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Muir-Torre syndrome (PMID: 9217825). This variant is also known as 289ins22. ClinVar contains an entry for this variant (Variation ID: 1761). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.2
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553350126; hg19: chr2-47635595;