rs1553350126

Variant names:

• chr2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC
• rs1553350126
• NM_000251.3:c.269_290dupAAGATCTTCTTCTGGTTCGTCA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_Moderate PP5_Very_Strong

The NM_001406654.1(MSH2):​c.-129-23_-129-2dupAAGATCTTCTTCTGGTTCGTCA variant causes a splice acceptor, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MSH2 NM_001406654.1 splice_acceptor, intron
• Clinical Significance: Pathogenic reviewed by expert panel P:3
• Conservation: PhyloP100: 6.19
• Publications: 1 publications found

Genes affected

MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

MSH2 Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
• Lynch syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
• Muir-Torre syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Genomics England PanelApp
• mismatch repair cancer syndrome 1

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• mismatch repair cancer syndrome 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• ovarian cancer

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• malignant pancreatic neoplasm

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• prostate cancer

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• breast cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.03196931 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PP5: Variant 2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC is Pathogenic according to our data. Variant chr2-47408456-A-AAAAGATCTTCTTCTGGTTCGTC is described in ClinVar as Pathogenic. ClinVar VariationId is 1761.Status of the report is reviewed_by_expert_panel, 3 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001406654.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH2	NM_000251.3	MANE Select	c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift	Exon 2 of 16	NP_000242.1	P43246-1
	MSH2	NM_001406674.1		c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift	Exon 2 of 18	NP_001393603.1
	MSH2	NM_001406631.1		c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift	Exon 2 of 18	NP_001393560.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH2	ENST00000233146.7	TSL:1 MANE Select	c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift	Exon 2 of 16	ENSP00000233146.2	P43246-1
	MSH2	ENST00000406134.5	TSL:1	c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift	Exon 2 of 16	ENSP00000384199.1	E9PHA6
	MSH2	ENST00000918107.1		c.269_290dupAAGATCTTCTTCTGGTTCGTCA	p.Tyr98ArgfsTer9	frameshift	Exon 2 of 17	ENSP00000588166.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
1	-	-	Hereditary nonpolyposis colorectal neoplasms (1)
1	-	-	Lynch syndrome (1)
1	-	-	Muir-Torré syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.2
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553350126; hg19: chr2-47635595;