2-47475020-TACAGGCTATGTAGAACCAATGCAGAC-T
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_ModeratePP5_Very_Strong
The NM_000251.3(MSH2):c.1760-2_1783delAGGCTATGTAGAACCAATGCAGACAC(p.Gly587_Leu595delinsVal) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G587G) has been classified as Likely benign.
Frequency
Consequence
NM_000251.3 splice_acceptor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Lynch syndrome 1 Pathogenic:1
This variant is considered pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -
not provided Pathogenic:1
This deletion of 26 nucleotides in MSH2 in denoted c.1760-2_1783del26 at the cDNA level. The surrounding sequence is atac[del26]TCAA, where the capital letters are exonic and lowercase are intronic. This deletion spans the intron/exon boundary, removing the canonical splice acceptor site. It is predicted to cause abnormal gene splicing, leading to either an abnormal message that is subject to nonsense-mediated mRNA decay or to an abnormal protein product. This variant has not, to our knowledge, been published in the literature. Based on the currently available information, we consider MSH2 c.1760-2_1783del26 to be a likely pathogenic variant. -
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
This variant results in the deletion of part of exon 12 (c.1760-2_1783del) of the MSH2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH2-related conditions. ClinVar contains an entry for this variant (Variation ID: 421732). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. This variant disrupts the p.Leu595 amino acid residue in MSH2. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 12454801, 23990280; Invitae). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.1760-2_1783del26 pathogenic mutation, spans from intron 11 into coding exon 12 of the MSH2 gene. This alteration results from a deletion of 26 nucleotides at positions c.1760-2 to c.1783, disrupting the canonical acceptor site. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as a disease-causing mutation. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at