rs1064795329

Positions:

• chr2-47475020-TACAGGCTATGTAGAACCAATGCAGAC-T

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_Moderate PM2 PP5_Very_Strong

The NM_000251.3(MSH2):​c.1760-2_1783delAGGCTATGTAGAACCAATGCAGACAC​(p.Gly587_Leu595delinsVal) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH2 NM_000251.3 splice_acceptor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 9.13

Genes affected

MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.08734403 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.4, offset of -38, new splice context is: tatatctgtttattattcAGtat. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-47475020-TACAGGCTATGTAGAACCAATGCAGAC-T is Pathogenic according to our data. Variant chr2-47475020-TACAGGCTATGTAGAACCAATGCAGAC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 421732.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MSH2	NM_000251.3	c.1760-2_1783delAGGCTATGTAGAACCAATGCAGACAC	p.Gly587_Leu595delinsVal	splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	12/16	ENST00000233146.7	NP_000242.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MSH2	ENST00000233146.7	c.1760-4_1781delACAGGCTATGTAGAACCAATGCAGAC	p.Gly587fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	12/16	1	NM_000251.3	ENSP00000233146.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Lynch syndrome 1 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Myriad Genetics, Inc.

Aug 03, 2023

This variant is considered pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Jul 12, 2016

This deletion of 26 nucleotides in MSH2 in denoted c.1760-2_1783del26 at the cDNA level. The surrounding sequence is atac[del26]TCAA, where the capital letters are exonic and lowercase are intronic. This deletion spans the intron/exon boundary, removing the canonical splice acceptor site. It is predicted to cause abnormal gene splicing, leading to either an abnormal message that is subject to nonsense-mediated mRNA decay or to an abnormal protein product. This variant has not, to our knowledge, been published in the literature. Based on the currently available information, we consider MSH2 c.1760-2_1783del26 to be a likely pathogenic variant. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 31, 2023

For these reasons, this variant has been classified as Pathogenic. This variant disrupts the p.Leu595 amino acid residue in MSH2. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 12454801, 23990280; Invitae). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 421732). This variant has not been reported in the literature in individuals affected with MSH2-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 12 (c.1760-2_1783del) of the MSH2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). -

Hereditary cancer-predisposing syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Feb 17, 2020

The c.1760-2_1783del26 pathogenic mutation, spans from intron 11 into coding exon 12 of the MSH2 gene. This alteration results from a deletion of 26 nucleotides at positions c.1760-2 to c.1783, disrupting the canonical acceptor site. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064795329; hg19: chr2-47702159;