chr2-47475020-TACAGGCTATGTAGAACCAATGCAGAC-T

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_ModeratePP5_Very_Strong

The NM_000251.3(MSH2):​c.1760-2_1783delAGGCTATGTAGAACCAATGCAGACAC​(p.Gly587_Leu595delinsVal) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G587G) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

MSH2
NM_000251.3 splice_acceptor, disruptive_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 9.13

Publications

0 publications found
Variant links:
Genes affected
MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
MSH2 Gene-Disease associations (from GenCC):
  • Lynch syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
  • Lynch syndrome 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
  • Muir-Torre syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
  • mismatch repair cancer syndrome 1
    Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • mismatch repair cancer syndrome 2
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
  • ovarian cancer
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • malignant pancreatic neoplasm
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • prostate cancer
    Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
  • rhabdomyosarcoma
    Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
  • breast cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
  • hereditary breast carcinoma
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.08770054 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.4, offset of -38, new splice context is: tatatctgtttattattcAGtat. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
PP5
Variant 2-47475020-TACAGGCTATGTAGAACCAATGCAGAC-T is Pathogenic according to our data. Variant chr2-47475020-TACAGGCTATGTAGAACCAATGCAGAC-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 421732.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH2NM_000251.3 linkc.1760-2_1783delAGGCTATGTAGAACCAATGCAGACAC p.Gly587_Leu595delinsVal splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 16 ENST00000233146.7 NP_000242.1 P43246-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH2ENST00000233146.7 linkc.1760-4_1781delACAGGCTATGTAGAACCAATGCAGAC p.Gly587fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 12 of 16 1 NM_000251.3 ENSP00000233146.2 P43246-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Lynch syndrome 1 Pathogenic:1
Aug 03, 2023
Myriad Genetics, Inc.
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is considered pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

not provided Pathogenic:1
Jul 12, 2016
GeneDx
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This deletion of 26 nucleotides in MSH2 in denoted c.1760-2_1783del26 at the cDNA level. The surrounding sequence is atac[del26]TCAA, where the capital letters are exonic and lowercase are intronic. This deletion spans the intron/exon boundary, removing the canonical splice acceptor site. It is predicted to cause abnormal gene splicing, leading to either an abnormal message that is subject to nonsense-mediated mRNA decay or to an abnormal protein product. This variant has not, to our knowledge, been published in the literature. Based on the currently available information, we consider MSH2 c.1760-2_1783del26 to be a likely pathogenic variant. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
May 31, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant results in the deletion of part of exon 12 (c.1760-2_1783del) of the MSH2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH2-related conditions. ClinVar contains an entry for this variant (Variation ID: 421732). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. This variant disrupts the p.Leu595 amino acid residue in MSH2. Other variant(s) that disrupt this residue have been determined to be pathogenic (PMID: 12454801, 23990280; Invitae). This suggests that this residue is clinically significant, and that variants that disrupt this residue are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1
Feb 17, 2020
Ambry Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.1760-2_1783del26 pathogenic mutation, spans from intron 11 into coding exon 12 of the MSH2 gene. This alteration results from a deletion of 26 nucleotides at positions c.1760-2 to c.1783, disrupting the canonical acceptor site. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1064795329; hg19: chr2-47702159; API