20-5106196-TGATGTAGCCTGACAGCAGGAGGGAGCCTATAATAATGAGAAAGGCGCCAATCAAAAACAGCACAGTGGCAAGTGCGATGGCCTTATAAGGGATCTTAGGAGGGGTTTTCTTAAACTGGAAGAGAAATAGAGATGAAAAAGACAACGAAGAACATTAATGCAAATACCTGGGTTCAAACATTTAATTAATTATTTGTAATTTTTATGTTTTTGTTTGTTTGTTTTGAGATGGAGTTTCGTTCTTGTTGCCCAGGCTAGAGAGCAATGGCGTGATCTTGGCTCACTGCAACCTCTGCCTCCTGGATTCAAGTGATTCTCCTGTCTCAGCCTCCTGAGCAGCTGGGGTTACAGGTGCCCGCCACTACACCCAGCTAATTTTTTTGGTATTTTTAGTAGAGACAGGGTTTCACCTTGTTGACCTGGCTGGGCTTGAACTCCTGACCTCAGGTGATCCGCCCGCCTCGGCCTCCCAAAGTGCTGGCATTACAGGCGTGAGCCACCGCGCCCGGCCTAATTTTTATGATTTTAGAGACGGAGTCTTGCTCTATCACCCAGGCTGGAGTGCAGTGGTGCAATTACAGCTCATTGCAGCCTCGAACTCCTGGGCTCAAGCAATTCTCTTGCCTCATCCTCTCAAGTAGCTGGGACTACAAGTATACGTCACCATGCCCAGCTAATTTTTAAATTTTTCTGTAGAGACGAGGTCTCACTATGTTGCCCAGGGTGGTCTCCAACTCCTGGGCTCAAGGGAGTCCTTCCACCTCTGCCTCCCAAAGTGCTGGGATTACAGGTATAAGCCATCAAGCCCAGTCTCAAACACTTTAAAACAGGGAGGAGAGCTCGCACCTGTAATCCCAGCAATGTGGGAGGCTGAGGCAGGCGGATCACTTGAGTTCAGGAGTTTGAGACCAGCCTGAGCAACATGGTGAAACCTCGTCTCTACAAAAAATACAAAAATTAGCC-T

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_Strong PM2 PP3

The ENST00000342308.10(TMEM230):c.289-848_402del variant causes a splice acceptor, coding sequence, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: TMEM230 ENST00000342308.10 splice_acceptor, coding_sequence, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.37

Genes affected

TMEM230 (HGNC:15876): (transmembrane protein 230) This gene encodes a multi-pass transmembrane protein that belongs to the TMEM134/TMEM230 protein family. The encoded protein localizes to secretory and recycling vesicle in the neuron and may be involved in synaptic vesicles trafficking and recycling. Mutations in this gene may be linked to familial Parkinson's disease. [provided by RefSeq, Mar 2017]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PVS1: Splicing variant, NOT destroyed by nmd, known LOF gene, truncates exone, which is 0.2210145 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
TMEM230	NM_001009923.2	c.289-848_402del		splice_acceptor_variant, coding_sequence_variant, intron_variant	4/5	ENST00000342308.10

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
TMEM230	ENST00000342308.10	c.289-848_402del		splice_acceptor_variant, coding_sequence_variant, intron_variant	4/5	2	NM_001009923.2

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Jan 21, 2022

This variant results in the deletion of part of exon 4 (c.289-848_402del) of the TMEM230 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), however the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in TMEM230 cause disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant has not been reported in the literature in individuals affected with TMEM230-related conditions. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr20-5086842;