21-43774637-CTCCTGAGGCCCACACTCTA-TT

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2

The NM_000100.4(CSTB):​c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

CSTB
NM_000100.4 splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 0.256
Variant links:
Genes affected
CSTB (HGNC:2482): (cystatin B) The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.34006733 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.8, offset of 25, new splice context is: ctgGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
CSTBNM_000100.4 linkuse as main transcriptc.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA splice_donor_variant, splice_region_variant, intron_variant ENST00000291568.7 NP_000091.1 P04080Q76LA1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
CSTBENST00000291568.7 linkuse as main transcriptc.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA splice_donor_variant, splice_region_variant, intron_variant 1 NM_000100.4 ENSP00000291568.6 P04080

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

Unverricht-Lundborg syndrome Other:1
not provided, no classification providedliterature onlyGeneReviews-- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs864309482; hg19: chr21-45194518; API