chr21-43774637-CTCCTGAGGCCCACACTCTA-TT

Variant names:

• chr21-43774637-CTCCTGAGGCCCACACTCTA-TT
• rs864309482
• NM_000100.4:c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_000100.4(CSTB):​c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CSTB NM_000100.4 splice_donor, splice_region, intron
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.256
• Publications: 1 publications found

Genes affected

CSTB (HGNC:2482): (cystatin B) The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]

CSTB Gene-Disease associations (from GenCC):

• Unverricht-Lundborg syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
• genetic developmental and epileptic encephalopathy

  Inheritance: AR Classification: MODERATE Submitted by: ClinGen
• autosomal recessive hypohidrotic ectodermal dysplasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.34343433 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.8, offset of 25, new splice context is: ctgGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000100.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CSTB	NM_000100.4	MANE Select	c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA		splice_donor splice_region intron	N/A	NP_000091.1	Q76LA1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CSTB	ENST00000291568.7	TSL:1 MANE Select	c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA		splice_donor splice_region intron	N/A	ENSP00000291568.6	P04080
	CSTB	ENST00000640406.1	TSL:2	c.170_189delTAGAGTGTGGGCCTCAGGAGinsAA	p.Val57_Gln62del	disruptive_inframe_deletion synonymous	Exon 2 of 2	ENSP00000492672.1	A0A1W2PS52
	CSTB	ENST00000896953.1		c.156+2_156+21delTAGAGTGTGGGCCTCAGGAGinsAA		splice_donor splice_region intron	N/A	ENSP00000567012.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: not provided

Revision: no classification provided

Pathogenic	VUS	Benign	Condition
-	-	-	Unverricht-Lundborg syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.26
Mutation Taster		=7/93	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs864309482; hg19: chr21-45194518;