chr21-43774637-CTCCTGAGGCCCACACTCTA-TT

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_000100.4(CSTB):​c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

CSTB
NM_000100.4 splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 0.256

Publications

1 publications found
Variant links:
Genes affected
CSTB (HGNC:2482): (cystatin B) The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]
CSTB Gene-Disease associations (from GenCC):
  • Unverricht-Lundborg syndrome
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Orphanet, Labcorp Genetics (formerly Invitae)
  • keratolytic winter erythema
    Inheritance: AD Classification: MODERATE Submitted by: PanelApp Australia
  • genetic developmental and epileptic encephalopathy
    Inheritance: AR Classification: MODERATE Submitted by: ClinGen
  • autosomal recessive hypohidrotic ectodermal dysplasia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.34343433 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.8, offset of 25, new splice context is: ctgGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CSTBNM_000100.4 linkc.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA splice_donor_variant, splice_region_variant, intron_variant Intron 2 of 2 ENST00000291568.7 NP_000091.1 P04080Q76LA1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CSTBENST00000291568.7 linkc.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA splice_donor_variant, splice_region_variant, intron_variant Intron 2 of 2 1 NM_000100.4 ENSP00000291568.6 P04080
CSTBENST00000640406.1 linkc.170_189delTAGAGTGTGGGCCTCAGGAGinsAA p.Val57_Gln62del disruptive_inframe_deletion, synonymous_variant Exon 2 of 2 2 ENSP00000492672.1 A0A1W2PS52
CSTBENST00000639959.1 linkc.34-326_34-307delTAGAGTGTGGGCCTCAGGAGinsAA intron_variant Intron 1 of 1 5 ENSP00000492123.1 A0A1W2PQG6
CSTBENST00000675996.1 linkn.593+2_593+21delTAGAGTGTGGGCCTCAGGAGinsAA splice_donor_variant, splice_region_variant, intron_variant Intron 2 of 2

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

Unverricht-Lundborg syndrome Other:1
-
GeneReviews
Significance:not provided
Review Status:no classification provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.26
Mutation Taster
=7/93
disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs864309482; hg19: chr21-45194518; API