rs864309482

Positions:

• chr21-43774637-CTCCTGAGGCCCACACTCTA-TT

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_000100.4(CSTB):​c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA variant causes a splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CSTB NM_000100.4 splice_donor, splice_region, intron
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 0.256

Genes affected

CSTB (HGNC:2482): (cystatin B) The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]

CSTB (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.34006733 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.8, offset of 25, new splice context is: ctgGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CSTB	NM_000100.4	c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA		splice_donor_variant, splice_region_variant, intron_variant		ENST00000291568.7	NP_000091.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CSTB	ENST00000291568.7	c.168+2_168+21delTAGAGTGTGGGCCTCAGGAGinsAA		splice_donor_variant, splice_region_variant, intron_variant		1	NM_000100.4	ENSP00000291568.6

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Unverricht-Lundborg syndrome Other:1

not provided, no classification provided

literature only

GeneReviews

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs864309482; hg19: chr21-45194518;