21-46334557-G-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA

Position:

• chr21-46334557-G-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA

Variant summary

Our verdict is Benign. Variant got -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BA1

The NM_006031.6(PCNT):​c.467_505dupATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC​(p.His156_Gln168dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0463 in 140,682 control chromosomes in the GnomAD database, including 215 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.046 (215 hom., cov: 33)
  • Exomes 𝑓: 0.014 (1406 hom.)
  • Failed GnomAD Quality Control
• Consequence: PCNT NM_006031.6 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:9
• Conservation: PhyloP100: 1.13

Genes affected

PCNT (HGNC:16068): (pericentrin) The protein encoded by this gene binds to calmodulin and is expressed in the centrosome. It is an integral component of the pericentriolar material (PCM). The protein contains a series of coiled-coil domains and a highly conserved PCM targeting motif called the PACT domain near its C-terminus. The protein interacts with the microtubule nucleation component gamma-tubulin and is likely important to normal functioning of the centrosomes, cytoskeleton, and cell-cycle progression. Mutations in this gene cause Seckel syndrome-4 and microcephalic osteodysplastic primordial dwarfism type II. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

PCNT (HGNC:):

ACMG classification

Verdict is Benign. Variant got -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006031.6.
• BP6: Variant 21-46334557-G-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA is Benign according to our data. Variant chr21-46334557-G-GTGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGCA is described in ClinVar as [Likely_benign]. Clinvar id is 211862.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0585 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PCNT	NM_006031.6	c.467_505dupATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His156_Gln168dup	disruptive_inframe_insertion	3/47	ENST00000359568.10	NP_006022.3
PCNT	NM_001315529.2	c.113_151dupATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His38_Gln50dup	disruptive_inframe_insertion	3/47		NP_001302458.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PCNT	ENST00000359568.10	c.467_505dupATGGGATGTTCACAGTCAGTGACCACCCACCAGAACAGC	p.His156_Gln168dup	disruptive_inframe_insertion	3/47	1	NM_006031.6	ENSP00000352572.5

Frequencies

GnomAD3 genomes AF: 0.0463 AC: 6515 AN: 140566 Hom.: 215 Cov.: 33

Gnomad AFR AF: 0.0606

Gnomad AMI AF: 0.0366

Gnomad AMR AF: 0.0367

Gnomad ASJ AF: 0.0521

Gnomad EAS AF: 0.00526

Gnomad SAS AF: 0.0172

Gnomad FIN AF: 0.0335

Gnomad MID AF: 0.0464

Gnomad NFE AF: 0.0475

Gnomad OTH AF: 0.0456

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0144 AC: 19791 AN: 1376124 Hom.: 1406 Cov.: 32 AF XY: 0.0146 AC XY: 9986 AN XY: 684758

Gnomad4 AFR exome AF: 0.0301

Gnomad4 AMR exome AF: 0.0103

Gnomad4 ASJ exome AF: 0.0349

Gnomad4 EAS exome AF: 0.00668

Gnomad4 SAS exome AF: 0.00509

Gnomad4 FIN exome AF: 0.0384

Gnomad4 NFE exome AF: 0.0131

Gnomad4 OTH exome AF: 0.0214

GnomAD4 genome AF: 0.0463 AC: 6519 AN: 140682 Hom.: 215 Cov.: 33 AF XY: 0.0437 AC XY: 3004 AN XY: 68752

Gnomad4 AFR AF: 0.0606

Gnomad4 AMR AF: 0.0366

Gnomad4 ASJ AF: 0.0521

Gnomad4 EAS AF: 0.00527

Gnomad4 SAS AF: 0.0170

Gnomad4 FIN AF: 0.0335

Gnomad4 NFE AF: 0.0475

Gnomad4 OTH AF: 0.0451

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:9

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:5

Benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Feb 01, 2024	- -
Benign, flagged submission	clinical testing	GeneDx	Jul 31, 2018	- -
Likely benign, no assertion criteria provided	clinical testing	Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen	-	- -
Likely benign, no assertion criteria provided	clinical testing	Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC)	-	- -
Benign, criteria provided, single submitter	clinical testing	GeneDx	Nov 29, 2017	- -

Microcephalic osteodysplastic primordial dwarfism type II Benign:2

Likely benign, criteria provided, single submitter	clinical testing	Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center	Feb 22, 2017	- -
Benign, criteria provided, single submitter	clinical testing	ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories	Nov 29, 2023	- -

not specified Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Jul 31, 2015

- -

PCNT-related disorder Benign:1

Benign, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Sep 28, 2021

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs587784306; hg19: chr21-47754471;