3-10141803-CGGATCCCGCGGCGTCCGGCCCGGGTGGTCT-C

Position:

• chr3-10141803-CGGATCCCGCGGCGTCCGGCCCGGGTGGTCT-C

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000551.4(VHL):​c.-39_-10delCCGCGGCGTCCGGCCCGGGTGGTCTGGATC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000723 in 1,382,822 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 7.2e-7 (0 hom.)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 3.08

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
VHL	NM_000551.4	c.-39_-10delCCGCGGCGTCCGGCCCGGGTGGTCTGGATC		5_prime_UTR_variant	1/3	ENST00000256474.3	NP_000542.1
VHL	NM_001354723.2	c.-39_-10delCCGCGGCGTCCGGCCCGGGTGGTCTGGATC		5_prime_UTR_variant	1/3		NP_001341652.1
VHL	NM_198156.3	c.-39_-10delCCGCGGCGTCCGGCCCGGGTGGTCTGGATC		5_prime_UTR_variant	1/2		NP_937799.1
VHL	NR_176335.1	n.32_61delCCGCGGCGTCCGGCCCGGGTGGTCTGGATC		non_coding_transcript_exon_variant	1/4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
VHL	ENST00000256474	c.-39_-10delCCGCGGCGTCCGGCCCGGGTGGTCTGGATC		5_prime_UTR_variant	1/3	1	NM_000551.4	ENSP00000256474.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 7.23e-7 AC: 1 AN: 1382822 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 681406

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.33e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Von Hippel-Lindau syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

All of Us Research Program, National Institutes of Health

Jun 09, 2024

This variant causes a 30-nucleotide deletion in the 5' untranslated region of the VHL gene. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with VHL-related disorders in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 15, 2023

This variant occurs in a non-coding region of the VHL gene. It does not change the encoded amino acid sequence of the VHL protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with VHL-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-10183487;