3-117509776-GTGGGAATTTGAATATTATAACAGATCC-GTGGGAATTTGAATATTATAACAGATCCTGGGAATTTGAATATTATAACAGATCC

Variant names:

• chr3-117509776-G-GTGGGAATTTGAATATTATAACAGATCC
• rs45617832
• XR_007096021.1:n.26459_26485dupGGAATTTGAATATTATAACAGATCCTG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The XR_007096021.1(LOC105374056):​n.26459_26485dupGGAATTTGAATATTATAACAGATCCTG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.391 in 150,732 control chromosomes in the GnomAD database, including 14,183 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.39 (14183 hom., cov: 24)
• Consequence: LOC105374056 XR_007096021.1 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.787
• Publications: 0 publications found

Genes affected

LOC105374056 (HGNC:):

LSAMP (HGNC:6705): (limbic system associated membrane protein) This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.552 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LOC105374056	XR_007096021.1	n.26459_26485dupGGAATTTGAATATTATAACAGATCCTG		non_coding_transcript_exon_variant	Exon 1 of 3
LOC105374056	XR_924361.3	n.26459_26485dupGGAATTTGAATATTATAACAGATCCTG		non_coding_transcript_exon_variant	Exon 1 of 4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LSAMP	ENST00000717962.1	n.536-169990_536-169989insGGATCTGTTATAATATTCAAATTCCCA		intron_variant	Intron 2 of 6

Frequencies

GnomAD3 genomes AF: 0.391 AC: 58930 AN: 150616 Hom.: 14188 Cov.: 24

Gnomad AFR AF: 0.125

Gnomad AMI AF: 0.368

Gnomad AMR AF: 0.325

Gnomad ASJ AF: 0.514

Gnomad EAS AF: 0.214

Gnomad SAS AF: 0.438

Gnomad FIN AF: 0.489

Gnomad MID AF: 0.522

Gnomad NFE AF: 0.557

Gnomad OTH AF: 0.407

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.391 AC: 58904 AN: 150732 Hom.: 14183 Cov.: 24 AF XY: 0.385 AC XY: 28309 AN XY: 73558

African (AFR) AF: 0.125 AC: 5168 AN: 41348

American (AMR) AF: 0.325 AC: 4912 AN: 15122

Ashkenazi Jewish (ASJ) AF: 0.514 AC: 1774 AN: 3454

East Asian (EAS) AF: 0.213 AC: 1087 AN: 5106

South Asian (SAS) AF: 0.438 AC: 2049 AN: 4678

European-Finnish (FIN) AF: 0.489 AC: 5054 AN: 10340

Middle Eastern (MID) AF: 0.524 AC: 153 AN: 292

European-Non Finnish (NFE) AF: 0.557 AC: 37539 AN: 67412

Other (OTH) AF: 0.403 AC: 835 AN: 2074

Alfa AF: 0.374 Hom.: 1322

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.79
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs45617832; hg19: chr3-117228623; COSMIC: COSV73322266;