rs45617832

Variant names:

• chr3-117509776-GTGGGAATTTGAATATTATAACAGATCC-G
• rs45617832
• XR_007096021.1:n.26459_26485delGGAATTTGAATATTATAACAGATCCTG

Your query was ambiguous. Multiple possible variants found:

• chr3-117509776-GTGGGAATTTGAATATTATAACAGATCC-G
• chr3-117509776-GTGGGAATTTGAATATTATAACAGATCC-GTGGGAATTTGAATATTATAACAGATCCTGGGAATTTGAATATTATAACAGATCC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The XR_007096021.1(LOC105374056):​n.26459_26485delGGAATTTGAATATTATAACAGATCCTG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 24)
• Consequence: LOC105374056 XR_007096021.1 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.70
• Publications: 0 publications found

Genes affected

LOC105374056 (HGNC:):

LSAMP (HGNC:6705): (limbic system associated membrane protein) This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LOC105374056	XR_007096021.1	n.26459_26485delGGAATTTGAATATTATAACAGATCCTG		non_coding_transcript_exon_variant	Exon 1 of 3
LOC105374056	XR_924361.3	n.26459_26485delGGAATTTGAATATTATAACAGATCCTG		non_coding_transcript_exon_variant	Exon 1 of 4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LSAMP	ENST00000717962.1	n.536-170016_536-169990delGGATCTGTTATAATATTCAAATTCCCA		intron_variant	Intron 2 of 6

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs45617832; hg19: chr3-117228623;