rs45617832

Variant names:

• chr3-117509776-GTGGGAATTTGAATATTATAACAGATCC-G
• rs45617832
• XR_007096021.1:n.26459_26485delGGAATTTGAATATTATAACAGATCCTG

Your query was ambiguous. Multiple possible variants found:

• chr3-117509776-GTGGGAATTTGAATATTATAACAGATCC-G
• chr3-117509776-GTGGGAATTTGAATATTATAACAGATCC-GTGGGAATTTGAATATTATAACAGATCCTGGGAATTTGAATATTATAACAGATCC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The XR_924361.3(LOC105374056):​n.26459_26485delGGAATTTGAATATTATAACAGATCCTG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 24)
• Consequence: LOC105374056 XR_924361.3 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.70
• Publications: 0 publications found

Genes affected

LOC105374056 (HGNC:):

LSAMP (HGNC:6705): (limbic system associated membrane protein) This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000717962.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
There are no transcript annotations for this variant.

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LSAMP	ENST00000717962.1		n.536-170016_536-169990delGGATCTGTTATAATATTCAAATTCCCA		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 24

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 24

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs45617832;

hg19: chr3-117228623;