XR_007096021.1:n.26459_26485dupGGAATTTGAATATTATAACAGATCCTG
Variant summary
Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1
The XR_007096021.1(LOC105374056):n.26459_26485dupGGAATTTGAATATTATAACAGATCCTG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.391 in 150,732 control chromosomes in the GnomAD database, including 14,183 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
XR_007096021.1 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000717962.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
There are no transcript annotations for this variant. | |||||||||
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LSAMP | ENST00000717962.1 | n.536-169990_536-169989insGGATCTGTTATAATATTCAAATTCCCA | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.391 AC: 58930AN: 150616Hom.: 14188 Cov.: 24 show subpopulations
GnomAD4 genome AF: 0.391 AC: 58904AN: 150732Hom.: 14183 Cov.: 24 AF XY: 0.385 AC XY: 28309AN XY: 73558 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at