3-128879695-A-AGCGGCTGCGGGCTCTTCCTGCGCACC

Variant names:

• chr3-128879695-A-AGCGGCTGCGGGCTCTTCCTGCGCACC
• NM_014049.5:c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_014049.5(ACAD9):​c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC​(p.Thr11AlafsTer44) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: ACAD9 NM_014049.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.781

Genes affected

ACAD9 (HGNC:21497): (acyl-CoA dehydrogenase family member 9) This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

ACAD9-DT (HGNC:56086): (ACAD9 divergent transcript)

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-128879695-A-AGCGGCTGCGGGCTCTTCCTGCGCACC is Pathogenic according to our data. Variant chr3-128879695-A-AGCGGCTGCGGGCTCTTCCTGCGCACC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2679733.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ACAD9	NM_014049.5	c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC	p.Thr11AlafsTer44	frameshift_variant	Exon 1 of 18	ENST00000308982.12	NP_054768.2
ACAD9	NM_001410805.1	c.-271_-246dupGCGGCTGCGGGCTCTTCCTGCGCACC		5_prime_UTR_variant	Exon 1 of 17		NP_001397734.1
ACAD9	NR_033426.2	n.77_102dupGCGGCTGCGGGCTCTTCCTGCGCACC		non_coding_transcript_exon_variant	Exon 1 of 18
ACAD9	XR_427367.4	n.77_102dupGCGGCTGCGGGCTCTTCCTGCGCACC		non_coding_transcript_exon_variant	Exon 1 of 11

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ACAD9	ENST00000308982.12	c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC	p.Thr11AlafsTer44	frameshift_variant	Exon 1 of 18	1	NM_014049.5	ENSP00000312618.7

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Acyl-CoA dehydrogenase 9 deficiency Pathogenic:1

Jun 29, 2022

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-128598538;