3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT

Variant names:

• chr3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT
• rs1194909078
• NM_006506.5:c.12_32dupGGCGCCTGCTGCTGCGGCGGC

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2 PM4 BP6

The NM_006506.5(RASA2):​c.12_32dupGGCGCCTGCTGCTGCGGCGGC​(p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000338 in 1,357,036 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0014 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00021 (0 hom.)
• Consequence: RASA2 NM_006506.5 disruptive_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 1.59

Genes affected

RASA2 (HGNC:9872): (RAS p21 protein activator 2) The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_006506.5.
• BP6: Variant 3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT is Benign according to our data. Variant chr3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 1317345.We mark this variant Likely_benign, oryginal submissions are: {Uncertain_significance=1, Benign=1, Likely_benign=2}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RASA2	NM_006506.5	c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	ENST00000286364.9	NP_006497.2
RASA2	NM_001303246.3	c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 25		NP_001290175.1
RASA2	NM_001303245.3	c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24		NP_001290174.1
RASA2	XM_047448652.1	c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 17		XP_047304608.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RASA2	ENST00000286364.9	c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	1	NM_006506.5	ENSP00000286364.3
RASA2	ENST00000515549.1	n.12_32dupGGCGCCTGCTGCTGCGGCGGC		non_coding_transcript_exon_variant	Exon 1 of 5	4		ENSP00000424293.1

Frequencies

GnomAD3 genomes AF: 0.00138 AC: 207 AN: 150376 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00458

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000530

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000119

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000178 AC: 1 AN: 56244 Hom.: 0 AF XY: 0.0000318 AC XY: 1 AN XY: 31426

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000986

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000208 AC: 251 AN: 1206552 Hom.: 0 Cov.: 31 AF XY: 0.000203 AC XY: 120 AN XY: 591784

Gnomad4 AFR exome AF: 0.00512

Gnomad4 AMR exome AF: 0.000112

Gnomad4 ASJ exome AF: 0.0000582

Gnomad4 EAS exome AF: 0.000251

Gnomad4 SAS exome AF: 0.0000863

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000101

Gnomad4 OTH exome AF: 0.000277

GnomAD4 genome AF: 0.00138 AC: 207 AN: 150484 Hom.: 0 Cov.: 32 AF XY: 0.00133 AC XY: 98 AN XY: 73528

Gnomad4 AFR AF: 0.00457

Gnomad4 AMR AF: 0.000530

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000194

Gnomad4 SAS AF: 0.000207

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000119

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:2

Feb 02, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.12_32dup, results in the insertion of 7 amino acid(s) of the RASA2 protein (p.Ala5_Ala11dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with RASA2-related conditions. ClinVar contains an entry for this variant (Variation ID: 1317345). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Sep 02, 2021

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Sep 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

RASA2: BS1 -

not specified Benign:1

Dec 06, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: RASA2 c.12_32dup21 (p.Ala5_Ala11dup) results in an in-frame duplication that is predicted to duplicate 7 amino acids into the encoded protein. The variant allele was found at a frequency of 0.00054 in 85008 control chromosomes, predominantly at a frequency of 0.0044 within the African or African-American subpopulation in the gnomAD database. The observed variant frequency within African or African-American control individuals in the gnomAD database is approximately 880 fold of the estimated maximal expected allele frequency for a pathogenic variant in RASA2 causing Noonan Syndrome phenotype (5e-06), strongly suggesting that the variant is a benign polymorphism found primarily in populations of African or African-American origin. To our knowledge, no occurrence of c.12_32dup21 in individuals affected with Noonan Syndrome and no experimental evidence demonstrating its impact on protein function have been reported. One clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as likely benign. Based on the evidence outlined above, the variant was classified as benign. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1194909078; hg19: chr3-141205928;