chr3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT

Variant names:

• chr3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT
• rs1194909078
• NM_006506.5:c.12_32dupGGCGCCTGCTGCTGCGGCGGC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_006506.5(RASA2):​c.12_32dupGGCGCCTGCTGCTGCGGCGGC​(p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000338 in 1,357,036 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0014 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00021 (0 hom.)
• Consequence: RASA2 NM_006506.5 disruptive_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 1.59
• Publications: 0 publications found

Genes affected

RASA2 (HGNC:9872): (RAS p21 protein activator 2) The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

RASA2 Gene-Disease associations (from GenCC):

• Noonan syndrome

  Inheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: ClinGen, Orphanet
• cardiofaciocutaneous syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Costello syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome with multiple lentigines

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome-like disorder with loose anagen hair

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006506.5.
• BP6: Variant 3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT is Benign according to our data. Variant chr3-141487086-G-GGCGGCGGCGGCGCCTGCTGCT is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 1317345.
• BS2: High AC in GnomAd4 at 207 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006506.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA2	NM_006506.5	MANE Select	c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	NP_006497.2
	RASA2	NM_001303246.3		c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 25	NP_001290175.1
	RASA2	NM_001303245.3		c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	NP_001290174.1	Q15283-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA2	ENST00000286364.9	TSL:1 MANE Select	c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 24	ENSP00000286364.3	Q15283-2
	RASA2	ENST00000930693.1		c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 25	ENSP00000600752.1
	RASA2	ENST00000950127.1		c.12_32dupGGCGCCTGCTGCTGCGGCGGC	p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla	disruptive_inframe_insertion	Exon 1 of 25	ENSP00000620186.1

Frequencies

GnomAD3 genomes AF: 0.00138 AC: 207 AN: 150376 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00458

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000530

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000194

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000119

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000178 AC: 1 AN: 56244 AF XY: 0.0000318

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000208 AC: 251 AN: 1206552 Hom.: 0 Cov.: 31 AF XY: 0.000203 AC XY: 120 AN XY: 591784

African (AFR) AF: 0.00512 AC: 122 AN: 23840

American (AMR) AF: 0.000112 AC: 2 AN: 17828

Ashkenazi Jewish (ASJ) AF: 0.0000582 AC: 1 AN: 17190

East Asian (EAS) AF: 0.000251 AC: 6 AN: 23874

South Asian (SAS) AF: 0.0000863 AC: 5 AN: 57942

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 41566

Middle Eastern (MID) AF: 0.00122 AC: 4 AN: 3270

European-Non Finnish (NFE) AF: 0.000101 AC: 98 AN: 974050

Other (OTH) AF: 0.000277 AC: 13 AN: 46992

GnomAD4 genome AF: 0.00138 AC: 207 AN: 150484 Hom.: 0 Cov.: 32 AF XY: 0.00133 AC XY: 98 AN XY: 73528

African (AFR) AF: 0.00457 AC: 189 AN: 41346

American (AMR) AF: 0.000530 AC: 8 AN: 15108

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3444

East Asian (EAS) AF: 0.000194 AC: 1 AN: 5148

South Asian (SAS) AF: 0.000207 AC: 1 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9876

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.000119 AC: 8 AN: 67438

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	2	not provided (3)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6
Mutation Taster		=77/23	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1194909078; hg19: chr3-141205928;