NM_006506.5:c.12_32dupGGCGCCTGCTGCTGCGGCGGC
Variant summary
Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2PM4BP6
The NM_006506.5(RASA2):c.12_32dupGGCGCCTGCTGCTGCGGCGGC(p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000338 in 1,357,036 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_006506.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 3 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RASA2 | NM_006506.5 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | ENST00000286364.9 | NP_006497.2 | |
RASA2 | NM_001303246.3 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 25 | NP_001290175.1 | ||
RASA2 | NM_001303245.3 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | NP_001290174.1 | ||
RASA2 | XM_047448652.1 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 17 | XP_047304608.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RASA2 | ENST00000286364.9 | c.12_32dupGGCGCCTGCTGCTGCGGCGGC | p.Ala11_Ser12insAlaProAlaAlaAlaAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | 1 | NM_006506.5 | ENSP00000286364.3 | ||
RASA2 | ENST00000515549.1 | n.12_32dupGGCGCCTGCTGCTGCGGCGGC | non_coding_transcript_exon_variant | Exon 1 of 5 | 4 | ENSP00000424293.1 |
Frequencies
GnomAD3 genomes AF: 0.00138 AC: 207AN: 150376Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000178 AC: 1AN: 56244Hom.: 0 AF XY: 0.0000318 AC XY: 1AN XY: 31426
GnomAD4 exome AF: 0.000208 AC: 251AN: 1206552Hom.: 0 Cov.: 31 AF XY: 0.000203 AC XY: 120AN XY: 591784
GnomAD4 genome AF: 0.00138 AC: 207AN: 150484Hom.: 0 Cov.: 32 AF XY: 0.00133 AC XY: 98AN XY: 73528
ClinVar
Submissions by phenotype
not provided Uncertain:1Benign:2
This variant, c.12_32dup, results in the insertion of 7 amino acid(s) of the RASA2 protein (p.Ala5_Ala11dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with RASA2-related conditions. ClinVar contains an entry for this variant (Variation ID: 1317345). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
- -
RASA2: BS1 -
not specified Benign:1
Variant summary: RASA2 c.12_32dup21 (p.Ala5_Ala11dup) results in an in-frame duplication that is predicted to duplicate 7 amino acids into the encoded protein. The variant allele was found at a frequency of 0.00054 in 85008 control chromosomes, predominantly at a frequency of 0.0044 within the African or African-American subpopulation in the gnomAD database. The observed variant frequency within African or African-American control individuals in the gnomAD database is approximately 880 fold of the estimated maximal expected allele frequency for a pathogenic variant in RASA2 causing Noonan Syndrome phenotype (5e-06), strongly suggesting that the variant is a benign polymorphism found primarily in populations of African or African-American origin. To our knowledge, no occurrence of c.12_32dup21 in individuals affected with Noonan Syndrome and no experimental evidence demonstrating its impact on protein function have been reported. One clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 and classified the variant as likely benign. Based on the evidence outlined above, the variant was classified as benign. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at