3-141487086-GGCGGCGGCGGCGCCTGCTGCT-G

Variant names:

• chr3-141487086-GGCGGCGGCGGCGCCTGCTGCT-G
• rs1194909078
• NM_006506.5:c.12_32delGGCGCCTGCTGCTGCGGCGGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_006506.5(RASA2):​c.12_32delGGCGCCTGCTGCTGCGGCGGC​(p.Ala5_Ala11del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000414 in 1,206,556 control chromosomes in the GnomAD database, including 1 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A4A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000041 (1 hom.)
• Consequence: RASA2 NM_006506.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.08

Genes affected

RASA2 (HGNC:9872): (RAS p21 protein activator 2) The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_006506.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RASA2	NM_006506.5	c.12_32delGGCGCCTGCTGCTGCGGCGGC	p.Ala5_Ala11del	disruptive_inframe_deletion	Exon 1 of 24	ENST00000286364.9	NP_006497.2
RASA2	NM_001303246.3	c.12_32delGGCGCCTGCTGCTGCGGCGGC	p.Ala5_Ala11del	disruptive_inframe_deletion	Exon 1 of 25		NP_001290175.1
RASA2	NM_001303245.3	c.12_32delGGCGCCTGCTGCTGCGGCGGC	p.Ala5_Ala11del	disruptive_inframe_deletion	Exon 1 of 24		NP_001290174.1
RASA2	XM_047448652.1	c.12_32delGGCGCCTGCTGCTGCGGCGGC	p.Ala5_Ala11del	disruptive_inframe_deletion	Exon 1 of 17		XP_047304608.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RASA2	ENST00000286364.9	c.12_32delGGCGCCTGCTGCTGCGGCGGC	p.Ala5_Ala11del	disruptive_inframe_deletion	Exon 1 of 24	1	NM_006506.5	ENSP00000286364.3
RASA2	ENST00000515549.1	n.12_32delGGCGCCTGCTGCTGCGGCGGC		non_coding_transcript_exon_variant	Exon 1 of 5	4		ENSP00000424293.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.0000356 AC: 2 AN: 56244 Hom.: 1 AF XY: 0.0000636 AC XY: 2 AN XY: 31426

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000197

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000414 AC: 5 AN: 1206556 Hom.: 1 AF XY: 0.00000676 AC XY: 4 AN XY: 591786

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000345

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000308

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1194909078; hg19: chr3-141205928;