chr3-141487086-GGCGGCGGCGGCGCCTGCTGCT-G

Variant names:

• chr3-141487085-TGGCGGCGGCGGCGCCTGCTGC-TG
• NM_006506.5:c.4_23delGCGGCGGCGGCGCCTGCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_006506.5(RASA2):​c.4_23delGCGGCGGCGGCGCCTGCTGC​(p.Ala2CysfsTer38) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RASA2 NM_006506.5 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.08
• Publications: 0 publications found

Genes affected

RASA2 (HGNC:9872): (RAS p21 protein activator 2) The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]

RASA2 Gene-Disease associations (from GenCC):

• Noonan syndrome

  Inheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: ClinGen, Orphanet
• cardiofaciocutaneous syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Costello syndrome

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome with multiple lentigines

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• Noonan syndrome-like disorder with loose anagen hair

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006506.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA2	NM_006506.5	MANE Select	c.4_23delGCGGCGGCGGCGCCTGCTGC	p.Ala2CysfsTer38	frameshift	Exon 1 of 24	NP_006497.2
	RASA2	NM_001303246.3		c.4_23delGCGGCGGCGGCGCCTGCTGC	p.Ala2CysfsTer38	frameshift	Exon 1 of 25	NP_001290175.1
	RASA2	NM_001303245.3		c.4_23delGCGGCGGCGGCGCCTGCTGC	p.Ala2CysfsTer38	frameshift	Exon 1 of 24	NP_001290174.1	Q15283-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RASA2	ENST00000286364.9	TSL:1 MANE Select	c.4_23delGCGGCGGCGGCGCCTGCTGC	p.Ala2CysfsTer38	frameshift	Exon 1 of 24	ENSP00000286364.3	Q15283-2
	RASA2	ENST00000930693.1		c.4_23delGCGGCGGCGGCGCCTGCTGC	p.Ala2CysfsTer38	frameshift	Exon 1 of 25	ENSP00000600752.1
	RASA2	ENST00000950127.1		c.4_23delGCGGCGGCGGCGCCTGCTGC	p.Ala2CysfsTer38	frameshift	Exon 1 of 25	ENSP00000620186.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr3-141205927;