NM_006506.5:c.12_32delGGCGCCTGCTGCTGCGGCGGC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_006506.5(RASA2):c.12_32delGGCGCCTGCTGCTGCGGCGGC(p.Ala5_Ala11del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000414 in 1,206,556 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A4A) has been classified as Likely benign.
Frequency
Consequence
NM_006506.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Noonan syndromeInheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: ClinGen, Orphanet
- cardiofaciocutaneous syndromeInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Costello syndromeInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Noonan syndrome with multiple lentiginesInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- Noonan syndrome-like disorder with loose anagen hairInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006506.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RASA2 | MANE Select | c.12_32delGGCGCCTGCTGCTGCGGCGGC | p.Ala5_Ala11del | disruptive_inframe_deletion | Exon 1 of 24 | NP_006497.2 | |||
| RASA2 | c.12_32delGGCGCCTGCTGCTGCGGCGGC | p.Ala5_Ala11del | disruptive_inframe_deletion | Exon 1 of 25 | NP_001290175.1 | ||||
| RASA2 | c.12_32delGGCGCCTGCTGCTGCGGCGGC | p.Ala5_Ala11del | disruptive_inframe_deletion | Exon 1 of 24 | NP_001290174.1 | Q15283-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RASA2 | TSL:1 MANE Select | c.12_32delGGCGCCTGCTGCTGCGGCGGC | p.Ala5_Ala11del | disruptive_inframe_deletion | Exon 1 of 24 | ENSP00000286364.3 | Q15283-2 | ||
| RASA2 | c.12_32delGGCGCCTGCTGCTGCGGCGGC | p.Ala5_Ala11del | disruptive_inframe_deletion | Exon 1 of 25 | ENSP00000600752.1 | ||||
| RASA2 | c.12_32delGGCGCCTGCTGCTGCGGCGGC | p.Ala5_Ala11del | disruptive_inframe_deletion | Exon 1 of 25 | ENSP00000620186.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.0000356 AC: 2AN: 56244 AF XY: 0.0000636 show subpopulations
GnomAD4 exome AF: 0.00000414 AC: 5AN: 1206556Hom.: 1 AF XY: 0.00000676 AC XY: 4AN XY: 591786 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at