3-25598292-GTGCTCTTTGGGCACTTAATTAAACATTGCAA-TTGCAATGTTTAATTAAGTGCCCAAAGAGCAC

Variant names:

• chr3-25598292-GTGCTCTTTGGGCACTTAATTAAACATTGCAA-TTGCAATGTTTAATTAAGTGCCCAAAGAGCAC
• NM_001330700.2:c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2 PP3

The NM_001330700.2(TOP2B):​c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA​(p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln) variant causes a stop retained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TOP2B NM_001330700.2 stop_retained
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.04

Genes affected

TOP2B (HGNC:11990): (DNA topoisomerase II beta) This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TOP2B	NM_001330700.2	c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA	p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln	stop_retained_variant		ENST00000264331.9	NP_001317629.1
TOP2B	NM_001330700.2	c.4869_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA		3_prime_UTR_variant	Exon 36 of 36	ENST00000264331.9	NP_001317629.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TOP2B	ENST00000264331.9	c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA	p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln	stop_retained_variant		5	NM_001330700.2	ENSP00000264331.4
TOP2B	ENST00000264331	c.4869_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA		3_prime_UTR_variant	Exon 36 of 36	5	NM_001330700.2	ENSP00000264331.4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Dec 14, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (Non-coding) in the TOP2B gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 5 amino acid(s) of the TOP2B protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TOP2B-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-25639783;