3-25598292-GTGCTCTTTGGGCACTTAATTAAACATTGCAA-TTGCAATGTTTAATTAAGTGCCCAAAGAGCAC
Variant summary
Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2PP3
The NM_001330700.2(TOP2B):c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA(p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln) variant causes a stop retained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001330700.2 stop_retained
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 3 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TOP2B | NM_001330700.2 | c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA | p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln | stop_retained_variant | ENST00000264331.9 | NP_001317629.1 | ||
TOP2B | NM_001330700.2 | c.4869_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA | 3_prime_UTR_variant | Exon 36 of 36 | ENST00000264331.9 | NP_001317629.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TOP2B | ENST00000264331.9 | c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA | p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln | stop_retained_variant | 5 | NM_001330700.2 | ENSP00000264331.4 | |||
TOP2B | ENST00000264331 | c.4869_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA | 3_prime_UTR_variant | Exon 36 of 36 | 5 | NM_001330700.2 | ENSP00000264331.4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Uncertain:1
This sequence change creates a premature translational stop signal (Non-coding) in the TOP2B gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 5 amino acid(s) of the TOP2B protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TOP2B-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.