NM_001330700.2:c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA

Variant names:

• chr3-25598292-GTGCTCTTTGGGCACTTAATTAAACATTGCAA-TTGCAATGTTTAATTAAGTGCCCAAAGAGCAC
• NM_001330700.2:c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP3

The NM_001330700.2(TOP2B):​c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA​(p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln) variant causes a stop retained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type MNV, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TOP2B NM_001330700.2 stop_retained
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.04
• Publications: 0 publications found

Genes affected

TOP2B (HGNC:11990): (DNA topoisomerase II beta) This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]

TOP2B Gene-Disease associations (from GenCC):

• B-cell immunodeficiency, distal limb anomalies, and urogenital malformations

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: ClinGen, Illumina, Ambry Genetics, PanelApp Australia
• neurodevelopmental disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001330700.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TOP2B	NM_001330700.2	MANE Select	c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA	p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln	stop_retained	N/A	NP_001317629.1	Q02880-1
	TOP2B	NM_001330700.2	MANE Select	c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA		3_prime_UTR	Exon 36 of 36	NP_001317629.1	Q02880-1
	TOP2B	NM_001068.3		c.4850_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA	p.PheAlaMetPheAsnTer1617CysAlaLeuTrpAlaLeuAsnTerThrLeuGln	stop_retained	N/A	NP_001059.2	Q59H80

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TOP2B	ENST00000264331.9	TSL:5 MANE Select	c.4865_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA	p.PheAlaMetPheAsnTer1622CysAlaLeuTrpAlaLeuAsnTerThrLeuGln	stop_retained	N/A	ENSP00000264331.4	Q02880-1
	TOP2B	ENST00000435706.7	TSL:1	c.4850_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA	p.PheAlaMetPheAsnTer1617CysAlaLeuTrpAlaLeuAsnTerThrLeuGln	stop_retained	N/A	ENSP00000396704.2
	TOP2B	ENST00000424225.2	TSL:1	c.4766_*15delTTGCAATGTTTAATTAAGTGCCCAAAGAGCACinsGTGCTCTTTGGGCACTTAATTAAACATTGCAA	p.PheAlaMetPheAsnTer1589CysAlaLeuTrpAlaLeuAsnTerThrLeuGln	stop_retained	N/A	ENSP00000391112.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr3-25639783;