3-37020387-G-GCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000249.4(MLH1):c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT(p.Ser339HisfsTer40) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,214 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. S339S) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000249.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Orphanet
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
- Lynch syndrome 1Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MLH1 | NM_000249.4 | c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT | p.Ser339HisfsTer40 | frameshift_variant | Exon 11 of 19 | ENST00000231790.8 | NP_000240.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MLH1 | ENST00000231790.8 | c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT | p.Ser339HisfsTer40 | frameshift_variant | Exon 11 of 19 | 1 | NM_000249.4 | ENSP00000231790.3 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome Cov.: 31
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1AN XY: 74370 show subpopulations
ClinVar
Submissions by phenotype
Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:2
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
The c.963_1014dup (p.Ser339Hisfs*40) variant in the MLH1 gene is predicted to introduce a premature translation termination codon. This variant has never been reported in general population databases. Therefore, this c.963_1014dup (p.Ser339Hisfs*40) variant is classified as pathogenic. -
Lynch syndrome Pathogenic:1
- -
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). This variant has not been reported in the literature in individuals with MLH1-related conditions. ClinVar contains an entry for this variant (Variation ID: 433861). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ser339Hisfs*40) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at