3-48466637-AGCAGGTACGTACCCAACCATGGGCTC-A

Variant names:

• chr3-48466637-AGCAGGTACGTACCCAACCATGGGCTC-A
• NM_033629.6:c.-13_13delTACGTACCCAACCATGGGCTCGCAGG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_007248.5(TREX1):​c.-18-25_-18delTACGTACCCAACCATGGGCTCGCAGG variant causes a splice acceptor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TREX1 NM_007248.5 splice_acceptor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.18

Genes affected

TREX1 (HGNC:12269): (three prime repair exonuclease 1) This gene encodes a nuclear protein with 3' exonuclease activity. The encoded protein may play a role in DNA repair and serve as a proofreading function for DNA polymerase. Mutations in this gene result in Aicardi-Goutieres syndrome, chilblain lupus, Cree encephalitis, and other diseases of the immune system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]

ATRIP (HGNC:33499): (ATR interacting protein) This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

ATRIP-TREX1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 1.0688524 fraction of the gene. Cryptic splice site detected, with MaxEntScore 6.4, offset of -12, new splice context is: caccccatgctcctctccAGgct. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TREX1	NM_033629.6	c.-13_13delTACGTACCCAACCATGGGCTCGCAGG	p.Met1fs	frameshift_variant, start_lost	Exon 2 of 2	ENST00000625293.3	NP_338599.1
TREX1	NM_033629.6	c.-13_13delTACGTACCCAACCATGGGCTCGCAGG		5_prime_UTR_variant	Exon 2 of 2	ENST00000625293.3	NP_338599.1
ATRIP	NM_130384.3	c.*1089_*1114delTACGTACCCAACCATGGGCTCGCAGG		3_prime_UTR_variant	Exon 13 of 13	ENST00000320211.10	NP_569055.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TREX1	ENST00000625293.3	c.-13_13delTACGTACCCAACCATGGGCTCGCAGG	p.Met1fs	frameshift_variant, start_lost	Exon 2 of 2	6	NM_033629.6	ENSP00000486676.2
TREX1	ENST00000625293	c.-13_13delTACGTACCCAACCATGGGCTCGCAGG		5_prime_UTR_variant	Exon 2 of 2		NM_033629.6	ENSP00000486676.2
ATRIP	ENST00000320211.10	c.*1089_*1114delTACGTACCCAACCATGGGCTCGCAGG		3_prime_UTR_variant	Exon 13 of 13	1	NM_130384.3	ENSP00000323099.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Chilblain lupus 1;C0796126:Aicardi-Goutieres syndrome 1;C1860518:Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations Uncertain:1

Dec 12, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the TREX1 mRNA. The next in-frame methionine is located at codon 11. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TREX1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr3-48508036;