chr3-48466637-AGCAGGTACGTACCCAACCATGGGCTC-A
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2
The NM_007248.5(TREX1):c.-18-25_-18delTACGTACCCAACCATGGGCTCGCAGG variant causes a splice acceptor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_007248.5 splice_acceptor, splice_region, 5_prime_UTR, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TREX1 | NM_033629.6 | c.-13_13delTACGTACCCAACCATGGGCTCGCAGG | p.Met1fs | frameshift_variant, start_lost | Exon 2 of 2 | ENST00000625293.3 | NP_338599.1 | |
TREX1 | NM_033629.6 | c.-13_13delTACGTACCCAACCATGGGCTCGCAGG | 5_prime_UTR_variant | Exon 2 of 2 | ENST00000625293.3 | NP_338599.1 | ||
ATRIP | NM_130384.3 | c.*1089_*1114delTACGTACCCAACCATGGGCTCGCAGG | 3_prime_UTR_variant | Exon 13 of 13 | ENST00000320211.10 | NP_569055.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TREX1 | ENST00000625293.3 | c.-13_13delTACGTACCCAACCATGGGCTCGCAGG | p.Met1fs | frameshift_variant, start_lost | Exon 2 of 2 | 6 | NM_033629.6 | ENSP00000486676.2 | ||
TREX1 | ENST00000625293 | c.-13_13delTACGTACCCAACCATGGGCTCGCAGG | 5_prime_UTR_variant | Exon 2 of 2 | NM_033629.6 | ENSP00000486676.2 | ||||
ATRIP | ENST00000320211.10 | c.*1089_*1114delTACGTACCCAACCATGGGCTCGCAGG | 3_prime_UTR_variant | Exon 13 of 13 | 1 | NM_130384.3 | ENSP00000323099.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Chilblain lupus 1;C0796126:Aicardi-Goutieres syndrome 1;C1860518:Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations Uncertain:1
This sequence change affects the initiator methionine of the TREX1 mRNA. The next in-frame methionine is located at codon 11. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TREX1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.