4-1002772-CGTCCTGGACAGCAACCACACGGTGGGC-G
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP7
The NM_000203.5(IDUA):c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG(p.Val411_Gly419del) variant causes a conservative inframe deletion, synonymous change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T410T) has been classified as Likely benign.
Frequency
Consequence
NM_000203.5 conservative_inframe_deletion, synonymous
Scores
Clinical Significance
Conservation
Publications
- mucopolysaccharidosis type 1Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Myriad Women’s Health
- Scheie syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Orphanet
- Hurler syndromeInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, PanelApp Australia
- Hurler-Scheie syndromeInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| IDUA | NM_000203.5 | c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val411_Gly419del | conservative_inframe_deletion, synonymous_variant | Exon 9 of 14 | ENST00000514224.2 | NP_000194.2 | |
| IDUA | NM_001363576.1 | c.834_861delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val279_Gly287del | conservative_inframe_deletion, synonymous_variant | Exon 8 of 13 | NP_001350505.1 | ||
| IDUA | XM_047415650.1 | c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val411_Gly419del | conservative_inframe_deletion, synonymous_variant | Exon 9 of 12 | XP_047271606.1 | ||
| IDUA | NR_110313.1 | n.1318_1345delCGTCCTGGACAGCAACCACACGGTGGGCinsG | non_coding_transcript_exon_variant | Exon 9 of 14 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Mucopolysaccharidosis type 1 Uncertain:1
This variant, c.1230_1257delinsG, results in the deletion of 9 amino acids of the IDUA protein (p.Asp413_Leu421del), but otherwise preserves the integrity of the reading frame. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with IDUA-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at