4-1002772-CGTCCTGGACAGCAACCACACGGTGGGC-G

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP7

The NM_000203.5(IDUA):​c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG​(p.Val411_Gly419del) variant causes a conservative inframe deletion, synonymous change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T410T) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

IDUA
NM_000203.5 conservative_inframe_deletion, synonymous

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.87

Publications

0 publications found
Variant links:
Genes affected
IDUA (HGNC:5391): (alpha-L-iduronidase) This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
IDUA Gene-Disease associations (from GenCC):
  • mucopolysaccharidosis type 1
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Myriad Women’s Health
  • Scheie syndrome
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Orphanet
  • Hurler syndrome
    Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, PanelApp Australia
  • Hurler-Scheie syndrome
    Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_000203.5.
BP7
Synonymous conserved (PhyloP=1.87 with no splicing effect.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
IDUANM_000203.5 linkc.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG p.Val411_Gly419del conservative_inframe_deletion, synonymous_variant Exon 9 of 14 ENST00000514224.2 NP_000194.2 P35475-1
IDUANM_001363576.1 linkc.834_861delCGTCCTGGACAGCAACCACACGGTGGGCinsG p.Val279_Gly287del conservative_inframe_deletion, synonymous_variant Exon 8 of 13 NP_001350505.1
IDUAXM_047415650.1 linkc.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG p.Val411_Gly419del conservative_inframe_deletion, synonymous_variant Exon 9 of 12 XP_047271606.1
IDUANR_110313.1 linkn.1318_1345delCGTCCTGGACAGCAACCACACGGTGGGCinsG non_coding_transcript_exon_variant Exon 9 of 14

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
IDUAENST00000514224.2 linkc.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG p.Val411_Gly419del conservative_inframe_deletion, synonymous_variant Exon 9 of 14 2 NM_000203.5 ENSP00000425081.2 P35475-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Mucopolysaccharidosis type 1 Uncertain:1
Oct 12, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.1230_1257delinsG, results in the deletion of 9 amino acids of the IDUA protein (p.Asp413_Leu421del), but otherwise preserves the integrity of the reading frame. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with IDUA-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553917376; hg19: chr4-996560; API