rs1553917376
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP7
The NM_000203.5(IDUA):c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG(p.Val411_Gly419del) variant causes a conservative inframe deletion, synonymous change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T410T) has been classified as Likely benign. The gene IDUA is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000203.5 conservative_inframe_deletion, synonymous
Scores
Clinical Significance
Conservation
Publications
- mucopolysaccharidosis type 1Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Myriad Women's Health
- Scheie syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P, Labcorp Genetics (formerly Invitae)
- Hurler syndromeInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- Hurler-Scheie syndromeInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000203.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| IDUA | MANE Select | c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val411_Gly419del | conservative_inframe_deletion synonymous | Exon 9 of 14 | NP_000194.2 | P35475-1 | ||
| IDUA | c.834_861delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val279_Gly287del | conservative_inframe_deletion synonymous | Exon 8 of 13 | NP_001350505.1 | ||||
| IDUA | n.1318_1345delCGTCCTGGACAGCAACCACACGGTGGGCinsG | non_coding_transcript_exon | Exon 9 of 14 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| IDUA | TSL:2 MANE Select | c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val411_Gly419del | conservative_inframe_deletion synonymous | Exon 9 of 14 | ENSP00000425081.2 | P35475-1 | ||
| IDUA | TSL:1 | c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val411_Gly419del | conservative_inframe_deletion synonymous | Exon 9 of 14 | ENSP00000247933.4 | P35475-1 | ||
| IDUA | c.1305_1332delCGTCCTGGACAGCAACCACACGGTGGGCinsG | p.Val436_Gly444del | conservative_inframe_deletion synonymous | Exon 10 of 15 | ENSP00000632448.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.