NM_000203.5:c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG

Variant names:

• chr4-1002772-CGTCCTGGACAGCAACCACACGGTGGGC-G
• rs1553917376
• NM_000203.5:c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 4P and 1B. PM2 PM4 BP7

The NM_000203.5(IDUA):​c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG​(p.Val411_Gly419del) variant causes a conservative inframe deletion, synonymous change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T410T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: IDUA NM_000203.5 conservative_inframe_deletion, synonymous
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.87

Genes affected

IDUA (HGNC:5391): (alpha-L-iduronidase) This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000203.5.
• BP7: Synonymous conserved (PhyloP=1.87 with no splicing effect.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IDUA	NM_000203.5	c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG	p.Val411_Gly419del	conservative_inframe_deletion, synonymous_variant	Exon 9 of 14	ENST00000514224.2	NP_000194.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IDUA	ENST00000514224.2	c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG	p.Val411_Gly419del	conservative_inframe_deletion, synonymous_variant	Exon 9 of 14	2	NM_000203.5	ENSP00000425081.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Mucopolysaccharidosis type 1 Uncertain:1

Oct 12, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1230_1257delinsG, results in the deletion of 9 amino acids of the IDUA protein (p.Asp413_Leu421del), but otherwise preserves the integrity of the reading frame. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with IDUA-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553917376; hg19: chr4-996560;