NM_000203.5:c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG

Variant names:

• chr4-1002772-CGTCCTGGACAGCAACCACACGGTGGGC-G
• rs1553917376
• NM_000203.5:c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4 BP7

The NM_000203.5(IDUA):​c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG​(p.Val411_Gly419del) variant causes a conservative inframe deletion, synonymous change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. T410T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: IDUA NM_000203.5 conservative_inframe_deletion, synonymous
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.87
• Publications: 0 publications found

Genes affected

IDUA (HGNC:5391): (alpha-L-iduronidase) This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]

IDUA Gene-Disease associations (from GenCC):

• mucopolysaccharidosis type 1

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Myriad Women’s Health
• Scheie syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Orphanet
• Hurler syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, PanelApp Australia
• Hurler-Scheie syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000203.5.
• BP7: Synonymous conserved (PhyloP=1.87 with no splicing effect.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000203.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IDUA	NM_000203.5	MANE Select	c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG	p.Val411_Gly419del	conservative_inframe_deletion synonymous	Exon 9 of 14	NP_000194.2
	IDUA	NM_001363576.1		c.834_861delCGTCCTGGACAGCAACCACACGGTGGGCinsG	p.Val279_Gly287del	conservative_inframe_deletion synonymous	Exon 8 of 13	NP_001350505.1
	IDUA	NR_110313.1		n.1318_1345delCGTCCTGGACAGCAACCACACGGTGGGCinsG		non_coding_transcript_exon	Exon 9 of 14

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	IDUA	ENST00000514224.2	TSL:2 MANE Select	c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG	p.Val411_Gly419del	conservative_inframe_deletion synonymous	Exon 9 of 14	ENSP00000425081.2
	IDUA	ENST00000247933.9	TSL:1	c.1230_1257delCGTCCTGGACAGCAACCACACGGTGGGCinsG	p.Val411_Gly419del	conservative_inframe_deletion synonymous	Exon 9 of 14	ENSP00000247933.4
	IDUA	ENST00000962389.1		c.1305_1332delCGTCCTGGACAGCAACCACACGGTGGGCinsG	p.Val436_Gly444del	conservative_inframe_deletion synonymous	Exon 10 of 15	ENSP00000632448.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Mucopolysaccharidosis type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553917376; hg19: chr4-996560;