4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T

Variant names:

• chr4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T
• NM_001963.6:c.-185_87del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001963.6(EGF):​c.-185_87del​(p.Met1fs) variant causes a frameshift, start lost change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: EGF NM_001963.6 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.36
• Publications: 0 publications found

Genes affected

EGF (HGNC:3229): (epidermal growth factor) This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

EGF Gene-Disease associations (from GenCC):

• familial primary hypomagnesemia with normocalciuria and normocalcemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• renal hypomagnesemia 4

  Inheritance: AD, Unknown Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EGF	NM_001963.6	c.-185_87del	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 24	ENST00000265171.10	NP_001954.2
EGF	NM_001963.6	c.-185_87del		5_prime_UTR_variant	Exon 1 of 24	ENST00000265171.10	NP_001954.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EGF	ENST00000265171.10	c.-185_87del	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 24	1	NM_001963.6	ENSP00000265171.5
EGF	ENST00000265171.10	c.-185_87del		5_prime_UTR_variant	Exon 1 of 24	1	NM_001963.6	ENSP00000265171.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Oct 28, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the EGF mRNA. The next in-frame methionine is located at codon 79. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with EGF-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr4-110834305;