4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_001963.6(EGF):c.-185_87del variant causes a start lost, 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: EGF NM_001963.6 start_lost, 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.36

Genes affected

EGF (HGNC:3229): (epidermal growth factor) This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
EGF	NM_001963.6	c.-185_87del		start_lost, 5_prime_UTR_variant	1/24	ENST00000265171.10
EGF	NM_001178130.3	c.-185_87del		start_lost, 5_prime_UTR_variant	1/23
EGF	NM_001178131.3	c.-185_87del		start_lost, 5_prime_UTR_variant	1/23
EGF	NM_001357021.2	c.-185_87del		start_lost, 5_prime_UTR_variant	1/20

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
EGF	ENST00000265171.10	c.-185_87del		start_lost, 5_prime_UTR_variant	1/24	1	NM_001963.6	P1
EGF	ENST00000503392.1			coding_sequence_variant, 5_prime_UTR_variant	1/23	1
EGF	ENST00000509793.5	c.-185_87del		start_lost, 5_prime_UTR_variant	1/23	2
EGF	ENST00000652245.1	c.-185_87del		start_lost, 5_prime_UTR_variant	1/20

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Oct 28, 2023

This sequence change affects the initiator methionine of the EGF mRNA. The next in-frame methionine is located at codon 79. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with EGF-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr4-110834305;